Incidental Mutation 'R6553:Dapk1'
ID 521794
Institutional Source Beutler Lab
Gene Symbol Dapk1
Ensembl Gene ENSMUSG00000021559
Gene Name death associated protein kinase 1
Synonyms DAP-Kinase, D13Ucla1, 2810425C21Rik, 2310039H24Rik
MMRRC Submission 044678-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6553 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 60749761-60911005 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 60908975 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 1196 (V1196E)
Ref Sequence ENSEMBL: ENSMUSP00000153607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044083] [ENSMUST00000077453] [ENSMUST00000226059]
AlphaFold Q80YE7
Predicted Effect probably damaging
Transcript: ENSMUST00000044083
AA Change: V1196E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040825
Gene: ENSMUSG00000021559
AA Change: V1196E

DomainStartEndE-ValueType
S_TKc 13 275 6.35e-99 SMART
low complexity region 295 306 N/A INTRINSIC
ANK 378 407 5.09e-2 SMART
ANK 411 440 6.61e-1 SMART
ANK 444 473 7.64e-6 SMART
ANK 477 506 2.13e-4 SMART
ANK 510 539 1.31e-4 SMART
ANK 543 572 7.83e-3 SMART
ANK 576 605 8.52e-4 SMART
ANK 609 638 1.85e-4 SMART
ANK 642 671 7.29e2 SMART
low complexity region 711 725 N/A INTRINSIC
DEATH 1299 1396 2.65e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077453
AA Change: V1196E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076666
Gene: ENSMUSG00000021559
AA Change: V1196E

DomainStartEndE-ValueType
S_TKc 13 275 6.35e-99 SMART
low complexity region 295 306 N/A INTRINSIC
ANK 378 407 5.09e-2 SMART
ANK 411 440 6.61e-1 SMART
ANK 444 473 7.64e-6 SMART
ANK 477 506 2.13e-4 SMART
ANK 510 539 1.31e-4 SMART
ANK 543 572 7.83e-3 SMART
ANK 576 605 8.52e-4 SMART
ANK 609 638 1.85e-4 SMART
ANK 642 671 7.29e2 SMART
low complexity region 711 725 N/A INTRINSIC
Pfam:COR 984 1176 4.2e-10 PFAM
DEATH 1299 1396 2.65e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225952
Predicted Effect probably damaging
Transcript: ENSMUST00000226059
AA Change: V1196E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Death-associated protein kinase 1 is a positive mediator of gamma-interferon induced programmed cell death. DAPK1 encodes a structurally unique 160-kD calmodulin dependent serine-threonine kinase that carries 8 ankyrin repeats and 2 putative P-loop consensus sites. It is a tumor suppressor candidate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show decreased sensitivity to ER stress-induced cell death and reduced tunicamycin-induced kidney damage. Mice homozygous for a gene trapped allele show decreased infarct size and neuronal death with improved neurological scores after ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1b G T 5: 121,639,250 (GRCm39) D598E probably benign Het
Ascc3 A G 10: 50,718,273 (GRCm39) K1989E probably benign Het
Asic5 A T 3: 81,916,773 (GRCm39) T288S possibly damaging Het
Chd1 A G 17: 15,945,692 (GRCm39) N72S probably benign Het
Ciita T A 16: 10,329,609 (GRCm39) V628E probably benign Het
Cyp2c50 A G 19: 40,079,046 (GRCm39) T130A probably benign Het
Dis3l2 T A 1: 86,673,216 (GRCm39) I69N probably damaging Het
Exph5 A G 9: 53,213,012 (GRCm39) probably benign Het
Fcgbp A T 7: 27,813,404 (GRCm39) Q2313L possibly damaging Het
Gm2888 A G 14: 3,037,722 (GRCm38) H238R possibly damaging Het
Gm5622 A G 14: 51,895,200 (GRCm39) K120E probably damaging Het
Gpr155 A T 2: 73,179,989 (GRCm39) I157N probably damaging Het
Hltf T C 3: 20,126,558 (GRCm39) V245A probably damaging Het
Kmt2e G A 5: 23,668,024 (GRCm39) V28I probably damaging Het
Lsm3 GATATATA GATATATATA 6: 91,496,617 (GRCm39) probably null Het
Nprl3 C T 11: 32,184,812 (GRCm39) R399Q probably benign Het
Or6c6c C T 10: 129,540,932 (GRCm39) R62C probably benign Het
Ptgs2 T C 1: 149,979,738 (GRCm39) V281A possibly damaging Het
Speer4f2 A G 5: 17,579,420 (GRCm39) E73G probably damaging Het
Tmem161b C A 13: 84,370,537 (GRCm39) probably benign Het
Trav13n-3 A G 14: 53,574,618 (GRCm39) T14A probably benign Het
Trav9d-4 A T 14: 53,221,198 (GRCm39) Q63L probably benign Het
Vmn2r75 T A 7: 85,813,453 (GRCm39) N450Y probably benign Het
Vmn2r97 G A 17: 19,150,566 (GRCm39) W471* probably null Het
Zfp27 G A 7: 29,595,818 (GRCm39) T49I possibly damaging Het
Zpld2 A G 4: 133,929,367 (GRCm39) S313P probably damaging Het
Other mutations in Dapk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dapk1 APN 13 60,908,854 (GRCm39) missense probably benign 0.23
IGL00500:Dapk1 APN 13 60,908,618 (GRCm39) missense probably damaging 0.96
IGL00801:Dapk1 APN 13 60,909,062 (GRCm39) missense probably benign 0.00
IGL00903:Dapk1 APN 13 60,909,211 (GRCm39) missense probably damaging 0.99
IGL01468:Dapk1 APN 13 60,908,612 (GRCm39) missense probably benign
IGL01535:Dapk1 APN 13 60,878,845 (GRCm39) splice site probably benign
IGL01755:Dapk1 APN 13 60,908,990 (GRCm39) missense possibly damaging 0.63
IGL01755:Dapk1 APN 13 60,908,989 (GRCm39) missense probably damaging 0.97
IGL01862:Dapk1 APN 13 60,874,424 (GRCm39) missense probably benign 0.39
IGL01985:Dapk1 APN 13 60,884,074 (GRCm39) missense probably damaging 1.00
IGL02124:Dapk1 APN 13 60,878,696 (GRCm39) missense probably benign
IGL02376:Dapk1 APN 13 60,844,208 (GRCm39) missense probably benign 0.00
IGL02449:Dapk1 APN 13 60,867,584 (GRCm39) splice site probably benign
IGL02490:Dapk1 APN 13 60,897,148 (GRCm39) missense probably damaging 1.00
IGL02503:Dapk1 APN 13 60,909,621 (GRCm39) nonsense probably null
IGL02516:Dapk1 APN 13 60,844,161 (GRCm39) missense probably damaging 1.00
IGL02544:Dapk1 APN 13 60,899,031 (GRCm39) missense probably benign
IGL02604:Dapk1 APN 13 60,896,134 (GRCm39) missense probably benign
IGL03035:Dapk1 APN 13 60,864,587 (GRCm39) missense probably damaging 0.99
H8562:Dapk1 UTSW 13 60,909,126 (GRCm39) missense probably damaging 0.98
P0026:Dapk1 UTSW 13 60,865,963 (GRCm39) splice site probably benign
R0116:Dapk1 UTSW 13 60,908,914 (GRCm39) missense probably benign
R0165:Dapk1 UTSW 13 60,909,407 (GRCm39) missense probably benign 0.39
R0357:Dapk1 UTSW 13 60,877,372 (GRCm39) nonsense probably null
R0446:Dapk1 UTSW 13 60,873,101 (GRCm39) splice site probably null
R0502:Dapk1 UTSW 13 60,878,662 (GRCm39) splice site probably null
R0503:Dapk1 UTSW 13 60,878,662 (GRCm39) splice site probably null
R0597:Dapk1 UTSW 13 60,909,198 (GRCm39) missense probably benign 0.40
R0614:Dapk1 UTSW 13 60,865,946 (GRCm39) missense probably damaging 1.00
R0751:Dapk1 UTSW 13 60,844,112 (GRCm39) missense probably damaging 1.00
R0930:Dapk1 UTSW 13 60,905,262 (GRCm39) missense probably benign 0.14
R1023:Dapk1 UTSW 13 60,878,799 (GRCm39) missense probably damaging 1.00
R1033:Dapk1 UTSW 13 60,869,679 (GRCm39) critical splice donor site probably null
R1101:Dapk1 UTSW 13 60,864,599 (GRCm39) missense probably damaging 1.00
R1184:Dapk1 UTSW 13 60,844,112 (GRCm39) missense probably damaging 1.00
R1430:Dapk1 UTSW 13 60,901,957 (GRCm39) missense probably benign 0.28
R1630:Dapk1 UTSW 13 60,877,345 (GRCm39) missense probably damaging 0.99
R1681:Dapk1 UTSW 13 60,866,278 (GRCm39) critical splice donor site probably null
R1799:Dapk1 UTSW 13 60,867,468 (GRCm39) missense probably damaging 1.00
R2012:Dapk1 UTSW 13 60,869,671 (GRCm39) missense probably damaging 1.00
R2068:Dapk1 UTSW 13 60,899,022 (GRCm39) missense probably damaging 1.00
R2131:Dapk1 UTSW 13 60,909,481 (GRCm39) missense possibly damaging 0.80
R2131:Dapk1 UTSW 13 60,877,345 (GRCm39) missense possibly damaging 0.91
R2154:Dapk1 UTSW 13 60,877,317 (GRCm39) missense probably benign 0.36
R2288:Dapk1 UTSW 13 60,909,563 (GRCm39) missense probably damaging 1.00
R2312:Dapk1 UTSW 13 60,905,167 (GRCm39) missense probably damaging 0.99
R2362:Dapk1 UTSW 13 60,878,745 (GRCm39) missense probably damaging 0.98
R2400:Dapk1 UTSW 13 60,900,030 (GRCm39) missense probably benign 0.34
R2909:Dapk1 UTSW 13 60,864,631 (GRCm39) critical splice donor site probably null
R2926:Dapk1 UTSW 13 60,867,564 (GRCm39) missense possibly damaging 0.58
R3741:Dapk1 UTSW 13 60,896,014 (GRCm39) missense probably benign 0.09
R3810:Dapk1 UTSW 13 60,908,503 (GRCm39) missense probably damaging 0.98
R4374:Dapk1 UTSW 13 60,867,498 (GRCm39) missense probably benign 0.01
R4375:Dapk1 UTSW 13 60,909,403 (GRCm39) missense probably benign
R4377:Dapk1 UTSW 13 60,867,498 (GRCm39) missense probably benign 0.01
R4490:Dapk1 UTSW 13 60,865,942 (GRCm39) missense probably benign 0.26
R4576:Dapk1 UTSW 13 60,869,636 (GRCm39) missense probably benign 0.13
R4599:Dapk1 UTSW 13 60,865,861 (GRCm39) missense probably benign 0.22
R4682:Dapk1 UTSW 13 60,898,961 (GRCm39) missense probably benign 0.41
R4717:Dapk1 UTSW 13 60,874,476 (GRCm39) critical splice donor site probably null
R4775:Dapk1 UTSW 13 60,897,156 (GRCm39) missense probably benign 0.02
R4790:Dapk1 UTSW 13 60,870,919 (GRCm39) frame shift probably null
R4897:Dapk1 UTSW 13 60,909,600 (GRCm39) missense probably benign 0.01
R4931:Dapk1 UTSW 13 60,908,774 (GRCm39) missense probably benign 0.04
R5113:Dapk1 UTSW 13 60,869,592 (GRCm39) missense probably benign 0.01
R5503:Dapk1 UTSW 13 60,873,126 (GRCm39) missense probably benign 0.15
R5948:Dapk1 UTSW 13 60,877,209 (GRCm39) missense probably damaging 0.97
R6012:Dapk1 UTSW 13 60,909,476 (GRCm39) missense probably benign 0.00
R6035:Dapk1 UTSW 13 60,909,013 (GRCm39) missense possibly damaging 0.46
R6035:Dapk1 UTSW 13 60,909,013 (GRCm39) missense possibly damaging 0.46
R6268:Dapk1 UTSW 13 60,909,580 (GRCm39) missense possibly damaging 0.91
R6330:Dapk1 UTSW 13 60,909,140 (GRCm39) missense probably benign 0.01
R6331:Dapk1 UTSW 13 60,877,256 (GRCm39) nonsense probably null
R6598:Dapk1 UTSW 13 60,909,161 (GRCm39) missense probably benign 0.03
R6602:Dapk1 UTSW 13 60,897,018 (GRCm39) missense probably benign 0.20
R6640:Dapk1 UTSW 13 60,864,628 (GRCm39) missense probably damaging 0.99
R6684:Dapk1 UTSW 13 60,908,708 (GRCm39) missense probably damaging 1.00
R6747:Dapk1 UTSW 13 60,873,154 (GRCm39) missense probably benign 0.22
R6799:Dapk1 UTSW 13 60,900,049 (GRCm39) missense probably benign
R6809:Dapk1 UTSW 13 60,899,103 (GRCm39) missense probably benign 0.00
R6915:Dapk1 UTSW 13 60,844,256 (GRCm39) missense probably damaging 1.00
R6949:Dapk1 UTSW 13 60,884,138 (GRCm39) missense probably benign 0.11
R6979:Dapk1 UTSW 13 60,896,095 (GRCm39) missense probably damaging 1.00
R7161:Dapk1 UTSW 13 60,844,209 (GRCm39) missense possibly damaging 0.89
R7171:Dapk1 UTSW 13 60,909,599 (GRCm39) missense probably damaging 0.97
R7199:Dapk1 UTSW 13 60,902,024 (GRCm39) missense probably benign 0.02
R7203:Dapk1 UTSW 13 60,844,149 (GRCm39) missense possibly damaging 0.90
R7404:Dapk1 UTSW 13 60,867,455 (GRCm39) missense probably benign 0.00
R7448:Dapk1 UTSW 13 60,898,990 (GRCm39) missense probably damaging 1.00
R7480:Dapk1 UTSW 13 60,905,311 (GRCm39) missense probably benign 0.18
R7532:Dapk1 UTSW 13 60,878,700 (GRCm39) missense probably damaging 1.00
R7574:Dapk1 UTSW 13 60,908,987 (GRCm39) missense probably damaging 1.00
R7711:Dapk1 UTSW 13 60,909,365 (GRCm39) missense probably damaging 1.00
R7753:Dapk1 UTSW 13 60,899,007 (GRCm39) missense possibly damaging 0.58
R7804:Dapk1 UTSW 13 60,873,153 (GRCm39) missense probably benign 0.41
R7822:Dapk1 UTSW 13 60,873,715 (GRCm39) missense probably benign 0.05
R7973:Dapk1 UTSW 13 60,909,377 (GRCm39) missense probably damaging 1.00
R8103:Dapk1 UTSW 13 60,897,009 (GRCm39) missense probably damaging 0.98
R8121:Dapk1 UTSW 13 60,909,212 (GRCm39) missense probably damaging 0.99
R8245:Dapk1 UTSW 13 60,878,710 (GRCm39) missense probably benign
R8401:Dapk1 UTSW 13 60,870,904 (GRCm39) missense probably benign 0.01
R8419:Dapk1 UTSW 13 60,887,911 (GRCm39) missense probably benign 0.00
R8926:Dapk1 UTSW 13 60,908,734 (GRCm39) missense probably damaging 0.98
R9063:Dapk1 UTSW 13 60,866,264 (GRCm39) missense probably benign 0.06
R9131:Dapk1 UTSW 13 60,909,208 (GRCm39) missense probably damaging 1.00
R9176:Dapk1 UTSW 13 60,866,262 (GRCm39) missense probably damaging 1.00
R9301:Dapk1 UTSW 13 60,866,125 (GRCm39) missense possibly damaging 0.92
R9407:Dapk1 UTSW 13 60,898,991 (GRCm39) nonsense probably null
R9491:Dapk1 UTSW 13 60,877,369 (GRCm39) missense probably benign 0.44
R9510:Dapk1 UTSW 13 60,910,203 (GRCm39) missense unknown
R9624:Dapk1 UTSW 13 60,895,937 (GRCm39) missense probably benign 0.31
R9726:Dapk1 UTSW 13 60,898,948 (GRCm39) missense probably benign 0.25
R9794:Dapk1 UTSW 13 60,909,082 (GRCm39) missense probably damaging 0.98
Z1176:Dapk1 UTSW 13 60,908,618 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATTGTCCCTGTAGAGCACCTC -3'
(R):5'- AACTCTCTTTCAGGGTCTGC -3'

Sequencing Primer
(F):5'- GTAGAGCACCTCACCCCCTTC -3'
(R):5'- TCTGCGCACGGAAGAAGTC -3'
Posted On 2018-06-06