Incidental Mutation 'R6553:Gm2888'
ID 521798
Institutional Source Beutler Lab
Gene Symbol Gm2888
Ensembl Gene ENSMUSG00000090487
Gene Name predicted gene 2888
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock # R6553 (G1)
Quality Score 122.008
Status Not validated
Chromosome 14
Chromosomal Location 3030002-3038762 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 3037722 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 238 (H238R)
Ref Sequence ENSEMBL: ENSMUSP00000132602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170521] [ENSMUST00000178577]
AlphaFold K7N746
Predicted Effect possibly damaging
Transcript: ENSMUST00000170521
AA Change: H238R

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132602
Gene: ENSMUSG00000090487
AA Change: H238R

DomainStartEndE-ValueType
Pfam:Takusan 48 128 3e-22 PFAM
transmembrane domain 240 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178577
SMART Domains Protein: ENSMUSP00000137316
Gene: ENSMUSG00000090487

DomainStartEndE-ValueType
Pfam:Takusan 46 129 5.7e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1b G T 5: 121,501,187 D598E probably benign Het
Ascc3 A G 10: 50,842,177 K1989E probably benign Het
Asic5 A T 3: 82,009,466 T288S possibly damaging Het
Chd1 A G 17: 15,725,430 N72S probably benign Het
Ciita T A 16: 10,511,745 V628E probably benign Het
Cyp2c50 A G 19: 40,090,602 T130A probably benign Het
Dapk1 T A 13: 60,761,161 V1196E probably damaging Het
Dis3l2 T A 1: 86,745,494 I69N probably damaging Het
Exph5 A G 9: 53,301,712 probably benign Het
Fcgbp A T 7: 28,113,979 Q2313L possibly damaging Het
Gm5622 A G 14: 51,657,743 K120E probably damaging Het
Gm7534 A G 4: 134,202,056 S313P probably damaging Het
Gpr155 A T 2: 73,349,645 I157N probably damaging Het
Hltf T C 3: 20,072,394 V245A probably damaging Het
Kmt2e G A 5: 23,463,026 V28I probably damaging Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Nprl3 C T 11: 32,234,812 R399Q probably benign Het
Olfr804 C T 10: 129,705,063 R62C probably benign Het
Ptgs2 T C 1: 150,103,987 V281A possibly damaging Het
Speer4f2 A G 5: 17,374,422 E73G probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Trav13n-3 A G 14: 53,337,161 T14A probably benign Het
Trav9d-4 A T 14: 52,983,741 Q63L probably benign Het
Vmn2r75 T A 7: 86,164,245 N450Y probably benign Het
Vmn2r97 G A 17: 18,930,304 W471* probably null Het
Zfp27 G A 7: 29,896,393 T49I possibly damaging Het
Other mutations in Gm2888
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Gm2888 APN 14 3032041 missense probably damaging 1.00
R2391:Gm2888 UTSW 14 3037656 missense possibly damaging 0.94
R8118:Gm2888 UTSW 14 3037628 missense probably benign 0.08
R9135:Gm2888 UTSW 14 3032106 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACACTTGGGATGCACGTTATG -3'
(R):5'- AGCTCTTGATGTGTCTCAGC -3'

Sequencing Primer
(F):5'- GATGCACGTTATGATCTCAGC -3'
(R):5'- ATGTGTCTCAGCATTTCTCTGAG -3'
Posted On 2018-06-06