Incidental Mutation 'R6526:Elf5'
ID521799
Institutional Source Beutler Lab
Gene Symbol Elf5
Ensembl Gene ENSMUSG00000027186
Gene NameE74-like factor 5
SynonymsESE-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6526 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location103411688-103450989 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103439233 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 53 (Y53C)
Ref Sequence ENSEMBL: ENSMUSP00000118565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028609] [ENSMUST00000126290] [ENSMUST00000164172] [ENSMUST00000171693]
Predicted Effect probably damaging
Transcript: ENSMUST00000028609
AA Change: Y53C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000028609
Gene: ENSMUSG00000027186
AA Change: Y53C

DomainStartEndE-ValueType
SAM_PNT 35 119 3.89e-39 SMART
ETS 160 246 4.96e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000126290
AA Change: Y53C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118565
Gene: ENSMUSG00000027186
AA Change: Y53C

DomainStartEndE-ValueType
SAM_PNT 35 119 3.89e-39 SMART
ETS 160 199 4.45e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137973
Predicted Effect probably damaging
Transcript: ENSMUST00000164172
AA Change: Y53C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126941
Gene: ENSMUSG00000027186
AA Change: Y53C

DomainStartEndE-ValueType
SAM_PNT 35 119 3.89e-39 SMART
ETS 160 246 4.96e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171693
AA Change: Y53C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131940
Gene: ENSMUSG00000027186
AA Change: Y53C

DomainStartEndE-ValueType
SAM_PNT 35 119 3.89e-39 SMART
ETS 160 246 4.96e-49 SMART
Meta Mutation Damage Score 0.2913 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality. Embryos homozygous for one null allele failed to develop extraembryonic ectoderm, did not maintain trophoblast stem cells, and had abnormal or absent mesoderm. Mice heterozygous for another allele had impaired lactation and mammary gland development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,284,172 probably null Het
Abcc3 C T 11: 94,359,372 G975D probably benign Het
Abhd13 G A 8: 9,987,777 G125S probably damaging Het
Ache T A 5: 137,290,644 L204Q probably damaging Het
Acnat2 A G 4: 49,383,497 S19P probably benign Het
Adprh A G 16: 38,447,276 Y216H probably benign Het
Anapc1 T A 2: 128,672,135 K429* probably null Het
Anxa13 T C 15: 58,344,957 noncoding transcript Het
Aprt A C 8: 122,576,816 L6W probably damaging Het
Arhgef15 T C 11: 68,949,994 T569A probably damaging Het
Atp11a T C 8: 12,864,999 L1139P probably benign Het
Atp2b4 A G 1: 133,711,729 S1136P probably damaging Het
B9d1 T A 11: 61,509,097 Y90* probably null Het
Btla G A 16: 45,239,094 A54T probably damaging Het
Cd63 T C 10: 128,911,489 V35A probably benign Het
Chek2 T C 5: 110,848,690 F173L probably damaging Het
Cntnap3 T A 13: 64,781,888 N499I possibly damaging Het
Cog4 T C 8: 110,881,786 L738P probably damaging Het
Cops6 T C 5: 138,163,900 probably null Het
Cpeb1 T A 7: 81,361,669 I175F probably benign Het
Cyp3a16 C T 5: 145,455,895 D174N probably benign Het
Dnah6 T G 6: 73,074,704 I2984L probably benign Het
Dock10 A T 1: 80,586,351 I540N probably damaging Het
Elmod2 T C 8: 83,319,457 T164A probably damaging Het
Epn3 A G 11: 94,494,932 probably null Het
Fam151a A T 4: 106,734,004 I15F possibly damaging Het
Gm11115 T A 5: 88,154,050 probably null Het
Gm13103 A G 4: 143,852,814 D323G probably damaging Het
Golga3 T A 5: 110,204,895 I884N probably damaging Het
Gria2 A T 3: 80,692,469 F703I probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gtpbp2 A T 17: 46,164,111 probably null Het
Herc2 T C 7: 56,157,330 S2419P probably damaging Het
Ikbkap T C 4: 56,798,812 probably null Het
Inpp5d T C 1: 87,676,250 probably benign Het
Kdm2b C A 5: 122,961,469 V136F probably damaging Het
Klra2 T A 6: 131,221,876 D234V probably benign Het
Lct A T 1: 128,300,478 S1093T probably benign Het
March9 A G 10: 127,056,689 L310P probably benign Het
Morc1 G T 16: 48,587,124 E668* probably null Het
Mum1 A G 10: 80,232,279 T86A probably benign Het
Nbas A T 12: 13,405,425 L1213F probably damaging Het
Neto1 A G 18: 86,498,748 T397A possibly damaging Het
Oit3 A G 10: 59,429,640 C268R probably damaging Het
Olfr476 A G 7: 107,967,462 T22A probably benign Het
Pcx T C 19: 4,604,495 F312L probably benign Het
Pitx2 T C 3: 129,214,783 probably null Het
Pkhd1l1 G A 15: 44,498,089 probably null Het
Polr1a C A 6: 71,929,443 D414E possibly damaging Het
Prkch T C 12: 73,702,775 Y381H probably damaging Het
Ptger3 T A 3: 157,567,502 V162E probably damaging Het
Ptgr2 T G 12: 84,313,952 M332R probably damaging Het
Ptprq G T 10: 107,542,653 S2009* probably null Het
Rangrf C T 11: 68,973,688 G11R probably damaging Het
Rbl2 A T 8: 91,096,839 Q465L probably benign Het
Rhbdd1 A T 1: 82,340,659 M88L probably benign Het
Setd2 G A 9: 110,532,717 M13I probably benign Het
Sirpb1a T C 3: 15,379,020 Y384C probably damaging Het
Slc13a1 C T 6: 24,097,612 G439S probably damaging Het
Slc41a1 T A 1: 131,841,149 I239N probably damaging Het
Slit2 T A 5: 48,304,167 C1502S probably damaging Het
Slit3 G A 11: 35,661,292 E888K probably benign Het
Srrm3 G T 5: 135,835,234 R62L probably damaging Het
Synm A G 7: 67,735,583 V777A possibly damaging Het
Trmt13 T A 3: 116,592,215 N31I probably damaging Het
Trpm8 G A 1: 88,361,998 E893K probably damaging Het
Uqcc1 A G 2: 155,851,423 F197S probably damaging Het
Vmn1r67 T A 7: 10,447,671 N287K probably benign Het
Vmn2r44 A T 7: 8,378,099 M265K probably benign Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xdh C A 17: 73,900,551 C937F probably damaging Het
Zfp846 T A 9: 20,593,871 N342K probably benign Het
Other mutations in Elf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01656:Elf5 APN 2 103442861 splice site probably benign
IGL03162:Elf5 APN 2 103430406 missense possibly damaging 0.56
R0329:Elf5 UTSW 2 103430420 splice site probably benign
R4667:Elf5 UTSW 2 103449060 missense probably damaging 1.00
R4906:Elf5 UTSW 2 103449573 nonsense probably null
R5768:Elf5 UTSW 2 103449022 missense probably damaging 1.00
R6307:Elf5 UTSW 2 103439412 missense probably damaging 1.00
R6418:Elf5 UTSW 2 103439352 missense possibly damaging 0.92
R6708:Elf5 UTSW 2 103448989 missense probably damaging 0.97
R7199:Elf5 UTSW 2 103439296 missense possibly damaging 0.70
R7263:Elf5 UTSW 2 103439300 missense probably benign 0.25
R7646:Elf5 UTSW 2 103439243 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- TGGTCCCAACAGCCATCTAC -3'
(R):5'- TGAAGTACAGGTACTCCCCAC -3'

Sequencing Primer
(F):5'- CTCTGTAGAGAAGATAACCTGGATCC -3'
(R):5'- GTACAGGTACTCCCCACAGATG -3'
Posted On2018-06-06