Incidental Mutation 'R6526:Anapc1'
ID521801
Institutional Source Beutler Lab
Gene Symbol Anapc1
Ensembl Gene ENSMUSG00000014355
Gene Nameanaphase promoting complex subunit 1
Synonyms2610021O03Rik, tsg24, Apc1, Mcpr
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6526 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location128610104-128687391 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 128672135 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 429 (K429*)
Ref Sequence ENSEMBL: ENSMUSP00000105962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014499] [ENSMUST00000110333]
Predicted Effect probably null
Transcript: ENSMUST00000014499
AA Change: K429*
SMART Domains Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: K429*

DomainStartEndE-ValueType
Pfam:ANAPC1 150 214 1.7e-13 PFAM
low complexity region 323 345 N/A INTRINSIC
low complexity region 1404 1415 N/A INTRINSIC
Pfam:PC_rep 1467 1501 8.3e-8 PFAM
low complexity region 1516 1528 N/A INTRINSIC
low complexity region 1924 1936 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110333
AA Change: K429*
SMART Domains Protein: ENSMUSP00000105962
Gene: ENSMUSG00000014355
AA Change: K429*

DomainStartEndE-ValueType
Pfam:Apc1 149 227 1.7e-22 PFAM
low complexity region 323 345 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134485
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,284,172 probably null Het
Abcc3 C T 11: 94,359,372 G975D probably benign Het
Abhd13 G A 8: 9,987,777 G125S probably damaging Het
Ache T A 5: 137,290,644 L204Q probably damaging Het
Acnat2 A G 4: 49,383,497 S19P probably benign Het
Adprh A G 16: 38,447,276 Y216H probably benign Het
Anxa13 T C 15: 58,344,957 noncoding transcript Het
Aprt A C 8: 122,576,816 L6W probably damaging Het
Arhgef15 T C 11: 68,949,994 T569A probably damaging Het
Atp11a T C 8: 12,864,999 L1139P probably benign Het
Atp2b4 A G 1: 133,711,729 S1136P probably damaging Het
B9d1 T A 11: 61,509,097 Y90* probably null Het
Btla G A 16: 45,239,094 A54T probably damaging Het
Cd63 T C 10: 128,911,489 V35A probably benign Het
Chek2 T C 5: 110,848,690 F173L probably damaging Het
Cntnap3 T A 13: 64,781,888 N499I possibly damaging Het
Cog4 T C 8: 110,881,786 L738P probably damaging Het
Cops6 T C 5: 138,163,900 probably null Het
Cpeb1 T A 7: 81,361,669 I175F probably benign Het
Cyp3a16 C T 5: 145,455,895 D174N probably benign Het
Dnah6 T G 6: 73,074,704 I2984L probably benign Het
Dock10 A T 1: 80,586,351 I540N probably damaging Het
Elf5 A G 2: 103,439,233 Y53C probably damaging Het
Elmod2 T C 8: 83,319,457 T164A probably damaging Het
Epn3 A G 11: 94,494,932 probably null Het
Fam151a A T 4: 106,734,004 I15F possibly damaging Het
Gm11115 T A 5: 88,154,050 probably null Het
Gm13103 A G 4: 143,852,814 D323G probably damaging Het
Golga3 T A 5: 110,204,895 I884N probably damaging Het
Gria2 A T 3: 80,692,469 F703I probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gtpbp2 A T 17: 46,164,111 probably null Het
Herc2 T C 7: 56,157,330 S2419P probably damaging Het
Ikbkap T C 4: 56,798,812 probably null Het
Inpp5d T C 1: 87,676,250 probably benign Het
Kdm2b C A 5: 122,961,469 V136F probably damaging Het
Klra2 T A 6: 131,221,876 D234V probably benign Het
Lct A T 1: 128,300,478 S1093T probably benign Het
March9 A G 10: 127,056,689 L310P probably benign Het
Morc1 G T 16: 48,587,124 E668* probably null Het
Mum1 A G 10: 80,232,279 T86A probably benign Het
Nbas A T 12: 13,405,425 L1213F probably damaging Het
Neto1 A G 18: 86,498,748 T397A possibly damaging Het
Oit3 A G 10: 59,429,640 C268R probably damaging Het
Olfr476 A G 7: 107,967,462 T22A probably benign Het
Pcx T C 19: 4,604,495 F312L probably benign Het
Pitx2 T C 3: 129,214,783 probably null Het
Pkhd1l1 G A 15: 44,498,089 probably null Het
Polr1a C A 6: 71,929,443 D414E possibly damaging Het
Prkch T C 12: 73,702,775 Y381H probably damaging Het
Ptger3 T A 3: 157,567,502 V162E probably damaging Het
Ptgr2 T G 12: 84,313,952 M332R probably damaging Het
Ptprq G T 10: 107,542,653 S2009* probably null Het
Rangrf C T 11: 68,973,688 G11R probably damaging Het
Rbl2 A T 8: 91,096,839 Q465L probably benign Het
Rhbdd1 A T 1: 82,340,659 M88L probably benign Het
Setd2 G A 9: 110,532,717 M13I probably benign Het
Sirpb1a T C 3: 15,379,020 Y384C probably damaging Het
Slc13a1 C T 6: 24,097,612 G439S probably damaging Het
Slc41a1 T A 1: 131,841,149 I239N probably damaging Het
Slit2 T A 5: 48,304,167 C1502S probably damaging Het
Slit3 G A 11: 35,661,292 E888K probably benign Het
Srrm3 G T 5: 135,835,234 R62L probably damaging Het
Synm A G 7: 67,735,583 V777A possibly damaging Het
Trmt13 T A 3: 116,592,215 N31I probably damaging Het
Trpm8 G A 1: 88,361,998 E893K probably damaging Het
Uqcc1 A G 2: 155,851,423 F197S probably damaging Het
Vmn1r67 T A 7: 10,447,671 N287K probably benign Het
Vmn2r44 A T 7: 8,378,099 M265K probably benign Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xdh C A 17: 73,900,551 C937F probably damaging Het
Zfp846 T A 9: 20,593,871 N342K probably benign Het
Other mutations in Anapc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Anapc1 APN 2 128645130 splice site probably benign
IGL00704:Anapc1 APN 2 128663984 missense possibly damaging 0.48
IGL01023:Anapc1 APN 2 128629729 missense probably damaging 1.00
IGL01432:Anapc1 APN 2 128633408 missense probably damaging 1.00
IGL01549:Anapc1 APN 2 128653170 missense probably benign
IGL02089:Anapc1 APN 2 128663933 missense probably damaging 1.00
IGL02275:Anapc1 APN 2 128659852 missense probably benign
IGL02570:Anapc1 APN 2 128645200 missense probably damaging 1.00
IGL02597:Anapc1 APN 2 128623931 missense probably benign 0.02
IGL02726:Anapc1 APN 2 128659785 missense probably benign 0.05
IGL03265:Anapc1 APN 2 128627197 missense probably damaging 1.00
IGL03304:Anapc1 APN 2 128627113 splice site probably benign
IGL03327:Anapc1 APN 2 128623934 missense probably benign 0.00
R0023:Anapc1 UTSW 2 128678218 missense probably damaging 0.99
R0027:Anapc1 UTSW 2 128641511 missense possibly damaging 0.96
R0027:Anapc1 UTSW 2 128641511 missense possibly damaging 0.96
R0084:Anapc1 UTSW 2 128623966 splice site probably benign
R0103:Anapc1 UTSW 2 128680452 splice site probably benign
R0103:Anapc1 UTSW 2 128680452 splice site probably benign
R0109:Anapc1 UTSW 2 128634693 missense probably damaging 1.00
R0109:Anapc1 UTSW 2 128634693 missense probably damaging 1.00
R0241:Anapc1 UTSW 2 128628629 missense possibly damaging 0.89
R0241:Anapc1 UTSW 2 128628629 missense possibly damaging 0.89
R0255:Anapc1 UTSW 2 128634711 missense probably damaging 0.99
R0377:Anapc1 UTSW 2 128641340 critical splice donor site probably null
R0467:Anapc1 UTSW 2 128669043 missense probably damaging 0.99
R0514:Anapc1 UTSW 2 128632655 missense probably damaging 0.99
R0591:Anapc1 UTSW 2 128619332 missense probably benign 0.17
R0919:Anapc1 UTSW 2 128617731 missense probably benign
R1175:Anapc1 UTSW 2 128680188 missense probably damaging 1.00
R1473:Anapc1 UTSW 2 128617697 missense possibly damaging 0.88
R1547:Anapc1 UTSW 2 128617556 missense probably benign 0.44
R1556:Anapc1 UTSW 2 128624899 missense probably benign 0.00
R1567:Anapc1 UTSW 2 128617716 missense probably damaging 1.00
R1635:Anapc1 UTSW 2 128628532 missense probably damaging 1.00
R1645:Anapc1 UTSW 2 128658246 critical splice donor site probably null
R1677:Anapc1 UTSW 2 128676208 missense probably benign 0.09
R1854:Anapc1 UTSW 2 128675890 missense probably damaging 1.00
R1856:Anapc1 UTSW 2 128659788 missense probably damaging 0.96
R1959:Anapc1 UTSW 2 128633415 missense probably benign 0.36
R1984:Anapc1 UTSW 2 128669688 missense possibly damaging 0.85
R2034:Anapc1 UTSW 2 128648458 missense possibly damaging 0.92
R2283:Anapc1 UTSW 2 128642548 missense probably benign 0.23
R2928:Anapc1 UTSW 2 128680137 missense probably damaging 1.00
R3547:Anapc1 UTSW 2 128642682 missense possibly damaging 0.58
R3904:Anapc1 UTSW 2 128642519 missense probably damaging 1.00
R4156:Anapc1 UTSW 2 128627229 intron probably benign
R4359:Anapc1 UTSW 2 128623556 missense possibly damaging 0.64
R4392:Anapc1 UTSW 2 128676249 critical splice acceptor site probably null
R4574:Anapc1 UTSW 2 128627195 missense probably damaging 1.00
R4682:Anapc1 UTSW 2 128664005 missense probably benign 0.05
R4770:Anapc1 UTSW 2 128686060 splice site probably benign
R4824:Anapc1 UTSW 2 128628690 missense possibly damaging 0.69
R4960:Anapc1 UTSW 2 128684594 missense probably benign 0.23
R5016:Anapc1 UTSW 2 128607175 unclassified probably benign
R5063:Anapc1 UTSW 2 128629549 missense possibly damaging 0.48
R5128:Anapc1 UTSW 2 128659917 missense probably benign
R5271:Anapc1 UTSW 2 128685985 nonsense probably null
R5363:Anapc1 UTSW 2 128650194 critical splice donor site probably null
R5469:Anapc1 UTSW 2 128675701 nonsense probably null
R5473:Anapc1 UTSW 2 128607195 unclassified probably benign
R5559:Anapc1 UTSW 2 128680434 nonsense probably null
R5631:Anapc1 UTSW 2 128657217 missense possibly damaging 0.85
R5747:Anapc1 UTSW 2 128624916 missense probably benign 0.19
R5840:Anapc1 UTSW 2 128607037 unclassified probably benign
R6226:Anapc1 UTSW 2 128650372 missense probably damaging 1.00
R6561:Anapc1 UTSW 2 128663999 missense probably damaging 0.98
R6743:Anapc1 UTSW 2 128684534 nonsense probably null
R6799:Anapc1 UTSW 2 128659737 missense probably null 0.38
R6887:Anapc1 UTSW 2 128659768 missense possibly damaging 0.91
R6978:Anapc1 UTSW 2 128669900 missense probably benign 0.06
R7011:Anapc1 UTSW 2 128648681 splice site probably null
R7041:Anapc1 UTSW 2 128628656 missense possibly damaging 0.88
R7047:Anapc1 UTSW 2 128615430 missense probably damaging 0.96
R7074:Anapc1 UTSW 2 128678274 missense probably damaging 1.00
R7109:Anapc1 UTSW 2 128674602 missense probably benign 0.33
R7123:Anapc1 UTSW 2 128613010 missense probably damaging 1.00
R7309:Anapc1 UTSW 2 128674684 missense probably damaging 0.96
R7693:Anapc1 UTSW 2 128641537 missense possibly damaging 0.86
R7839:Anapc1 UTSW 2 128684608 missense probably damaging 0.99
R7847:Anapc1 UTSW 2 128669908 missense possibly damaging 0.93
R7960:Anapc1 UTSW 2 128674593 missense probably damaging 1.00
R8061:Anapc1 UTSW 2 128648488 missense probably damaging 0.98
R8127:Anapc1 UTSW 2 128632627 missense probably damaging 0.96
R8228:Anapc1 UTSW 2 128619917 nonsense probably null
R8402:Anapc1 UTSW 2 128630228 missense probably benign 0.02
R8422:Anapc1 UTSW 2 128675837 missense probably benign
R8425:Anapc1 UTSW 2 128669868 missense probably damaging 1.00
R8553:Anapc1 UTSW 2 128619913 missense possibly damaging 0.80
X0066:Anapc1 UTSW 2 128674701 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ACCTGCTTCTCCATAAGGCTAC -3'
(R):5'- GCACTTGAGAAGGCTGTACTC -3'

Sequencing Primer
(F):5'- TGCTTCTCCATAAGGCTACAGAGG -3'
(R):5'- TTGAGAAGGCTGTACTCAAGTAG -3'
Posted On2018-06-06