Mutagenetix > Incidental Mutations

Incidental Mutation 'R6526:Anapc1'

521801

Institutional Source

Beutler Lab

Gene Symbol

Anapc1

Ensembl Gene

ENSMUSG00000014355

Gene Name

anaphase promoting complex subunit 1

Synonyms

2610021O03Rik, tsg24, Apc1, Mcpr

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6526 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

128610104-128687391 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 128672135 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 429 (K429*)

Ref Sequence

ENSEMBL: ENSMUSP00000105962 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014499] [ENSMUST00000110333]

AlphaFold

P53995

Predicted Effect

probably null
Transcript: ENSMUST00000014499
AA Change: K429*

SMART Domains

Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: K429*

Domain	Start	End	E-Value	Type
Pfam:ANAPC1	150	214	1.7e-13	PFAM
low complexity region	323	345	N/A	INTRINSIC
low complexity region	1404	1415	N/A	INTRINSIC
Pfam:PC_rep	1467	1501	8.3e-8	PFAM
low complexity region	1516	1528	N/A	INTRINSIC
low complexity region	1924	1936	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000110333
AA Change: K429*

SMART Domains

Protein: ENSMUSP00000105962
Gene: ENSMUSG00000014355
AA Change: K429*

Domain	Start	End	E-Value	Type
Pfam:Apc1	149	227	1.7e-22	PFAM
low complexity region	323	345	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134485

Meta Mutation Damage Score

0.9713

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.5%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aamp	A	G	1: 74,284,172		probably null	Het
Abcc3	C	T	11: 94,359,372	G975D	probably benign	Het
Abhd13	G	A	8: 9,987,777	G125S	probably damaging	Het
Ache	T	A	5: 137,290,644	L204Q	probably damaging	Het
Acnat2	A	G	4: 49,383,497	S19P	probably benign	Het
Adprh	A	G	16: 38,447,276	Y216H	probably benign	Het
Anxa13	T	C	15: 58,344,957		noncoding transcript	Het
Aprt	A	C	8: 122,576,816	L6W	probably damaging	Het
Arhgef15	T	C	11: 68,949,994	T569A	probably damaging	Het
Atp11a	T	C	8: 12,864,999	L1139P	probably benign	Het
Atp2b4	A	G	1: 133,711,729	S1136P	probably damaging	Het
B9d1	T	A	11: 61,509,097	Y90*	probably null	Het
Btla	G	A	16: 45,239,094	A54T	probably damaging	Het
Cd63	T	C	10: 128,911,489	V35A	probably benign	Het
Chek2	T	C	5: 110,848,690	F173L	probably damaging	Het
Cntnap3	T	A	13: 64,781,888	N499I	possibly damaging	Het
Cog4	T	C	8: 110,881,786	L738P	probably damaging	Het
Cops6	T	C	5: 138,163,900		probably null	Het
Cpeb1	T	A	7: 81,361,669	I175F	probably benign	Het
Cyp3a16	C	T	5: 145,455,895	D174N	probably benign	Het
Dnah6	T	G	6: 73,074,704	I2984L	probably benign	Het
Dock10	A	T	1: 80,586,351	I540N	probably damaging	Het
Elf5	A	G	2: 103,439,233	Y53C	probably damaging	Het
Elmod2	T	C	8: 83,319,457	T164A	probably damaging	Het
Epn3	A	G	11: 94,494,932		probably null	Het
Fam151a	A	T	4: 106,734,004	I15F	possibly damaging	Het
Gm11115	T	A	5: 88,154,050		probably null	Het
Gm13103	A	G	4: 143,852,814	D323G	probably damaging	Het
Golga3	T	A	5: 110,204,895	I884N	probably damaging	Het
Gria2	A	T	3: 80,692,469	F703I	probably damaging	Het
Gtf2h3	C	T	5: 124,584,297	T121I	probably benign	Het
Gtpbp2	A	T	17: 46,164,111		probably null	Het
Herc2	T	C	7: 56,157,330	S2419P	probably damaging	Het
Ikbkap	T	C	4: 56,798,812		probably null	Het
Inpp5d	T	C	1: 87,676,250		probably benign	Het
Kdm2b	C	A	5: 122,961,469	V136F	probably damaging	Het
Klra2	T	A	6: 131,221,876	D234V	probably benign	Het
Lct	A	T	1: 128,300,478	S1093T	probably benign	Het
March9	A	G	10: 127,056,689	L310P	probably benign	Het
Morc1	G	T	16: 48,587,124	E668*	probably null	Het
Mum1	A	G	10: 80,232,279	T86A	probably benign	Het
Nbas	A	T	12: 13,405,425	L1213F	probably damaging	Het
Neto1	A	G	18: 86,498,748	T397A	possibly damaging	Het
Oit3	A	G	10: 59,429,640	C268R	probably damaging	Het
Olfr476	A	G	7: 107,967,462	T22A	probably benign	Het
Pcx	T	C	19: 4,604,495	F312L	probably benign	Het
Pitx2	T	C	3: 129,214,783		probably null	Het
Pkhd1l1	G	A	15: 44,498,089		probably null	Het
Polr1a	C	A	6: 71,929,443	D414E	possibly damaging	Het
Prkch	T	C	12: 73,702,775	Y381H	probably damaging	Het
Ptger3	T	A	3: 157,567,502	V162E	probably damaging	Het
Ptgr2	T	G	12: 84,313,952	M332R	probably damaging	Het
Ptprq	G	T	10: 107,542,653	S2009*	probably null	Het
Rangrf	C	T	11: 68,973,688	G11R	probably damaging	Het
Rbl2	A	T	8: 91,096,839	Q465L	probably benign	Het
Rhbdd1	A	T	1: 82,340,659	M88L	probably benign	Het
Setd2	G	A	9: 110,532,717	M13I	probably benign	Het
Sirpb1a	T	C	3: 15,379,020	Y384C	probably damaging	Het
Slc13a1	C	T	6: 24,097,612	G439S	probably damaging	Het
Slc41a1	T	A	1: 131,841,149	I239N	probably damaging	Het
Slit2	T	A	5: 48,304,167	C1502S	probably damaging	Het
Slit3	G	A	11: 35,661,292	E888K	probably benign	Het
Srrm3	G	T	5: 135,835,234	R62L	probably damaging	Het
Synm	A	G	7: 67,735,583	V777A	possibly damaging	Het
Trmt13	T	A	3: 116,592,215	N31I	probably damaging	Het
Trpm8	G	A	1: 88,361,998	E893K	probably damaging	Het
Uqcc1	A	G	2: 155,851,423	F197S	probably damaging	Het
Vmn1r67	T	A	7: 10,447,671	N287K	probably benign	Het
Vmn2r44	A	T	7: 8,378,099	M265K	probably benign	Het
Wwc1	C	T	11: 35,853,437	E853K	probably benign	Het
Xdh	C	A	17: 73,900,551	C937F	probably damaging	Het
Zfp846	T	A	9: 20,593,871	N342K	probably benign	Het

Other mutations in Anapc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Anapc1	APN	2	128645130	splice site	probably benign
IGL00704:Anapc1	APN	2	128663984	missense	possibly damaging	0.48
IGL01023:Anapc1	APN	2	128629729	missense	probably damaging	1.00
IGL01432:Anapc1	APN	2	128633408	missense	probably damaging	1.00
IGL01549:Anapc1	APN	2	128653170	missense	probably benign
IGL02089:Anapc1	APN	2	128663933	missense	probably damaging	1.00
IGL02275:Anapc1	APN	2	128659852	missense	probably benign
IGL02570:Anapc1	APN	2	128645200	missense	probably damaging	1.00
IGL02597:Anapc1	APN	2	128623931	missense	probably benign	0.02
IGL02726:Anapc1	APN	2	128659785	missense	probably benign	0.05
IGL03265:Anapc1	APN	2	128627197	missense	probably damaging	1.00
IGL03304:Anapc1	APN	2	128627113	splice site	probably benign
IGL03327:Anapc1	APN	2	128623934	missense	probably benign	0.00
R0023:Anapc1	UTSW	2	128678218	missense	probably damaging	0.99
R0027:Anapc1	UTSW	2	128641511	missense	possibly damaging	0.96
R0027:Anapc1	UTSW	2	128641511	missense	possibly damaging	0.96
R0084:Anapc1	UTSW	2	128623966	splice site	probably benign
R0103:Anapc1	UTSW	2	128680452	splice site	probably benign
R0103:Anapc1	UTSW	2	128680452	splice site	probably benign
R0109:Anapc1	UTSW	2	128634693	missense	probably damaging	1.00
R0109:Anapc1	UTSW	2	128634693	missense	probably damaging	1.00
R0241:Anapc1	UTSW	2	128628629	missense	possibly damaging	0.89
R0241:Anapc1	UTSW	2	128628629	missense	possibly damaging	0.89
R0255:Anapc1	UTSW	2	128634711	missense	probably damaging	0.99
R0377:Anapc1	UTSW	2	128641340	critical splice donor site	probably null
R0467:Anapc1	UTSW	2	128669043	missense	probably damaging	0.99
R0514:Anapc1	UTSW	2	128632655	missense	probably damaging	0.99
R0591:Anapc1	UTSW	2	128619332	missense	probably benign	0.17
R0919:Anapc1	UTSW	2	128617731	missense	probably benign
R1175:Anapc1	UTSW	2	128680188	missense	probably damaging	1.00
R1473:Anapc1	UTSW	2	128617697	missense	possibly damaging	0.88
R1547:Anapc1	UTSW	2	128617556	missense	probably benign	0.44
R1556:Anapc1	UTSW	2	128624899	missense	probably benign	0.00
R1567:Anapc1	UTSW	2	128617716	missense	probably damaging	1.00
R1635:Anapc1	UTSW	2	128628532	missense	probably damaging	1.00
R1645:Anapc1	UTSW	2	128658246	critical splice donor site	probably null
R1677:Anapc1	UTSW	2	128676208	missense	probably benign	0.09
R1854:Anapc1	UTSW	2	128675890	missense	probably damaging	1.00
R1856:Anapc1	UTSW	2	128659788	missense	probably damaging	0.96
R1959:Anapc1	UTSW	2	128633415	missense	probably benign	0.36
R1984:Anapc1	UTSW	2	128669688	missense	possibly damaging	0.85
R2034:Anapc1	UTSW	2	128648458	missense	possibly damaging	0.92
R2283:Anapc1	UTSW	2	128642548	missense	probably benign	0.23
R2928:Anapc1	UTSW	2	128680137	missense	probably damaging	1.00
R3547:Anapc1	UTSW	2	128642682	missense	possibly damaging	0.58
R3904:Anapc1	UTSW	2	128642519	missense	probably damaging	1.00
R4156:Anapc1	UTSW	2	128627229	intron	probably benign
R4359:Anapc1	UTSW	2	128623556	missense	possibly damaging	0.64
R4392:Anapc1	UTSW	2	128676249	critical splice acceptor site	probably null
R4574:Anapc1	UTSW	2	128627195	missense	probably damaging	1.00
R4682:Anapc1	UTSW	2	128664005	missense	probably benign	0.05
R4770:Anapc1	UTSW	2	128686060	splice site	probably benign
R4824:Anapc1	UTSW	2	128628690	missense	possibly damaging	0.69
R4960:Anapc1	UTSW	2	128684594	missense	probably benign	0.23
R5016:Anapc1	UTSW	2	128607175	unclassified	probably benign
R5063:Anapc1	UTSW	2	128629549	missense	possibly damaging	0.48
R5128:Anapc1	UTSW	2	128659917	missense	probably benign
R5271:Anapc1	UTSW	2	128685985	nonsense	probably null
R5363:Anapc1	UTSW	2	128650194	critical splice donor site	probably null
R5469:Anapc1	UTSW	2	128675701	nonsense	probably null
R5473:Anapc1	UTSW	2	128607195	unclassified	probably benign
R5559:Anapc1	UTSW	2	128680434	nonsense	probably null
R5631:Anapc1	UTSW	2	128657217	missense	possibly damaging	0.85
R5747:Anapc1	UTSW	2	128624916	missense	probably benign	0.19
R5840:Anapc1	UTSW	2	128607037	unclassified	probably benign
R6226:Anapc1	UTSW	2	128650372	missense	probably damaging	1.00
R6561:Anapc1	UTSW	2	128663999	missense	probably damaging	0.98
R6743:Anapc1	UTSW	2	128684534	nonsense	probably null
R6799:Anapc1	UTSW	2	128659737	missense	probably null	0.38
R6887:Anapc1	UTSW	2	128659768	missense	possibly damaging	0.91
R6978:Anapc1	UTSW	2	128669900	missense	probably benign	0.06
R7011:Anapc1	UTSW	2	128648681	splice site	probably null
R7041:Anapc1	UTSW	2	128628656	missense	possibly damaging	0.88
R7047:Anapc1	UTSW	2	128615430	missense	probably damaging	0.96
R7074:Anapc1	UTSW	2	128678274	missense	probably damaging	1.00
R7109:Anapc1	UTSW	2	128674602	missense	probably benign	0.33
R7123:Anapc1	UTSW	2	128613010	missense	probably damaging	1.00
R7309:Anapc1	UTSW	2	128674684	missense	probably damaging	0.96
R7693:Anapc1	UTSW	2	128641537	missense	possibly damaging	0.86
R7839:Anapc1	UTSW	2	128684608	missense	probably damaging	0.99
R7847:Anapc1	UTSW	2	128669908	missense	possibly damaging	0.93
R7960:Anapc1	UTSW	2	128674593	missense	probably damaging	1.00
R8061:Anapc1	UTSW	2	128648488	missense	probably damaging	0.98
R8127:Anapc1	UTSW	2	128632627	missense	probably damaging	0.96
R8228:Anapc1	UTSW	2	128619917	nonsense	probably null
R8402:Anapc1	UTSW	2	128630228	missense	probably benign	0.02
R8422:Anapc1	UTSW	2	128675837	missense	probably benign
R8425:Anapc1	UTSW	2	128669868	missense	probably damaging	1.00
R8469:Anapc1	UTSW	2	128658344	splice site	probably null
R8553:Anapc1	UTSW	2	128619913	missense	possibly damaging	0.80
R8688:Anapc1	UTSW	2	128685828	missense	probably benign	0.19
R8699:Anapc1	UTSW	2	128641453	missense	probably damaging	1.00
R8719:Anapc1	UTSW	2	128641449	missense	probably damaging	1.00
R8775:Anapc1	UTSW	2	128657173	missense	possibly damaging	0.92
R8775-TAIL:Anapc1	UTSW	2	128657173	missense	possibly damaging	0.92
R8806:Anapc1	UTSW	2	128622413	missense	possibly damaging	0.67
R8973:Anapc1	UTSW	2	128664032	missense	probably damaging	0.99
R8977:Anapc1	UTSW	2	128641402	missense	probably damaging	1.00
R9000:Anapc1	UTSW	2	128634708	missense	probably damaging	1.00
R9080:Anapc1	UTSW	2	128622506	missense	possibly damaging	0.82
X0066:Anapc1	UTSW	2	128674701	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- ACCTGCTTCTCCATAAGGCTAC -3'
(R):5'- GCACTTGAGAAGGCTGTACTC -3'

Sequencing Primer
(F):5'- TGCTTCTCCATAAGGCTACAGAGG -3'
(R):5'- TTGAGAAGGCTGTACTCAAGTAG -3'

Posted On

2018-06-06