Incidental Mutation 'R6526:Uqcc1'
ID521803
Institutional Source Beutler Lab
Gene Symbol Uqcc1
Ensembl Gene ENSMUSG00000005882
Gene Nameubiquinol-cytochrome c reductase complex assembly factor 1
SynonymsBfzp, 3110038N19Rik, 2410003P15Rik, 2310079L17Rik, Cbp3, mbFZb, Uqcc
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.595) question?
Stock #R6526 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location155846894-155930310 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155851423 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 197 (F197S)
Ref Sequence ENSEMBL: ENSMUSP00000122886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006036] [ENSMUST00000109631] [ENSMUST00000109632] [ENSMUST00000109636] [ENSMUST00000133726] [ENSMUST00000136933] [ENSMUST00000151078] [ENSMUST00000152766]
Predicted Effect probably damaging
Transcript: ENSMUST00000006036
AA Change: F150S

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000006036
Gene: ENSMUSG00000005882
AA Change: F150S

DomainStartEndE-ValueType
Pfam:Ubiq_cyt_C_chap 105 191 8.1e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109631
AA Change: F162S

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105259
Gene: ENSMUSG00000005882
AA Change: F162S

DomainStartEndE-ValueType
Pfam:Ubiq_cyt_C_chap 63 203 2.1e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109632
AA Change: F204S

PolyPhen 2 Score 0.764 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105260
Gene: ENSMUSG00000005882
AA Change: F204S

DomainStartEndE-ValueType
Pfam:Ubiq_cyt_C_chap 131 191 4.3e-19 PFAM
Pfam:Ubiq_cyt_C_chap 188 245 2.9e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109636
AA Change: F230S

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105264
Gene: ENSMUSG00000005882
AA Change: F230S

DomainStartEndE-ValueType
Pfam:Ubiq_cyt_C_chap 131 271 6.7e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123790
Predicted Effect probably benign
Transcript: ENSMUST00000133726
Predicted Effect probably benign
Transcript: ENSMUST00000136933
Predicted Effect unknown
Transcript: ENSMUST00000139232
AA Change: F196S
SMART Domains Protein: ENSMUSP00000123019
Gene: ENSMUSG00000005882
AA Change: F196S

DomainStartEndE-ValueType
Pfam:Ubiq_cyt_C_chap 98 238 2e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151078
Predicted Effect probably damaging
Transcript: ENSMUST00000152766
AA Change: F197S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122886
Gene: ENSMUSG00000005882
AA Change: F197S

DomainStartEndE-ValueType
Pfam:Ubiq_cyt_C_chap 98 238 3.4e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161484
Meta Mutation Damage Score 0.7830 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is structurally similar to the mouse basic fibroblast growth factor repressed ZIC-binding protein. In mouse this protein may be involved in fibroblast growth factor regulated growth control. In humans, polymorphisms in this gene are associated with variation in human height and osteoarthritis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,284,172 probably null Het
Abcc3 C T 11: 94,359,372 G975D probably benign Het
Abhd13 G A 8: 9,987,777 G125S probably damaging Het
Ache T A 5: 137,290,644 L204Q probably damaging Het
Acnat2 A G 4: 49,383,497 S19P probably benign Het
Adprh A G 16: 38,447,276 Y216H probably benign Het
Anapc1 T A 2: 128,672,135 K429* probably null Het
Anxa13 T C 15: 58,344,957 noncoding transcript Het
Aprt A C 8: 122,576,816 L6W probably damaging Het
Arhgef15 T C 11: 68,949,994 T569A probably damaging Het
Atp11a T C 8: 12,864,999 L1139P probably benign Het
Atp2b4 A G 1: 133,711,729 S1136P probably damaging Het
B9d1 T A 11: 61,509,097 Y90* probably null Het
Btla G A 16: 45,239,094 A54T probably damaging Het
Cd63 T C 10: 128,911,489 V35A probably benign Het
Chek2 T C 5: 110,848,690 F173L probably damaging Het
Cntnap3 T A 13: 64,781,888 N499I possibly damaging Het
Cog4 T C 8: 110,881,786 L738P probably damaging Het
Cops6 T C 5: 138,163,900 probably null Het
Cpeb1 T A 7: 81,361,669 I175F probably benign Het
Cyp3a16 C T 5: 145,455,895 D174N probably benign Het
Dnah6 T G 6: 73,074,704 I2984L probably benign Het
Dock10 A T 1: 80,586,351 I540N probably damaging Het
Elf5 A G 2: 103,439,233 Y53C probably damaging Het
Elmod2 T C 8: 83,319,457 T164A probably damaging Het
Epn3 A G 11: 94,494,932 probably null Het
Fam151a A T 4: 106,734,004 I15F possibly damaging Het
Gm11115 T A 5: 88,154,050 probably null Het
Gm13103 A G 4: 143,852,814 D323G probably damaging Het
Golga3 T A 5: 110,204,895 I884N probably damaging Het
Gria2 A T 3: 80,692,469 F703I probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gtpbp2 A T 17: 46,164,111 probably null Het
Herc2 T C 7: 56,157,330 S2419P probably damaging Het
Ikbkap T C 4: 56,798,812 probably null Het
Inpp5d T C 1: 87,676,250 probably benign Het
Kdm2b C A 5: 122,961,469 V136F probably damaging Het
Klra2 T A 6: 131,221,876 D234V probably benign Het
Lct A T 1: 128,300,478 S1093T probably benign Het
March9 A G 10: 127,056,689 L310P probably benign Het
Morc1 G T 16: 48,587,124 E668* probably null Het
Mum1 A G 10: 80,232,279 T86A probably benign Het
Nbas A T 12: 13,405,425 L1213F probably damaging Het
Neto1 A G 18: 86,498,748 T397A possibly damaging Het
Oit3 A G 10: 59,429,640 C268R probably damaging Het
Olfr476 A G 7: 107,967,462 T22A probably benign Het
Pcx T C 19: 4,604,495 F312L probably benign Het
Pitx2 T C 3: 129,214,783 probably null Het
Pkhd1l1 G A 15: 44,498,089 probably null Het
Polr1a C A 6: 71,929,443 D414E possibly damaging Het
Prkch T C 12: 73,702,775 Y381H probably damaging Het
Ptger3 T A 3: 157,567,502 V162E probably damaging Het
Ptgr2 T G 12: 84,313,952 M332R probably damaging Het
Ptprq G T 10: 107,542,653 S2009* probably null Het
Rangrf C T 11: 68,973,688 G11R probably damaging Het
Rbl2 A T 8: 91,096,839 Q465L probably benign Het
Rhbdd1 A T 1: 82,340,659 M88L probably benign Het
Setd2 G A 9: 110,532,717 M13I probably benign Het
Sirpb1a T C 3: 15,379,020 Y384C probably damaging Het
Slc13a1 C T 6: 24,097,612 G439S probably damaging Het
Slc41a1 T A 1: 131,841,149 I239N probably damaging Het
Slit2 T A 5: 48,304,167 C1502S probably damaging Het
Slit3 G A 11: 35,661,292 E888K probably benign Het
Srrm3 G T 5: 135,835,234 R62L probably damaging Het
Synm A G 7: 67,735,583 V777A possibly damaging Het
Trmt13 T A 3: 116,592,215 N31I probably damaging Het
Trpm8 G A 1: 88,361,998 E893K probably damaging Het
Vmn1r67 T A 7: 10,447,671 N287K probably benign Het
Vmn2r44 A T 7: 8,378,099 M265K probably benign Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xdh C A 17: 73,900,551 C937F probably damaging Het
Zfp846 T A 9: 20,593,871 N342K probably benign Het
Other mutations in Uqcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01950:Uqcc1 APN 2 155858138 missense probably damaging 1.00
IGL02883:Uqcc1 APN 2 155911829 missense possibly damaging 0.93
R0433:Uqcc1 UTSW 2 155910368 missense probably damaging 1.00
R1506:Uqcc1 UTSW 2 155911818 missense probably damaging 0.98
R1579:Uqcc1 UTSW 2 155921721 nonsense probably null
R4801:Uqcc1 UTSW 2 155858106 splice site probably benign
R5049:Uqcc1 UTSW 2 155910421 missense probably damaging 1.00
R6042:Uqcc1 UTSW 2 155921644 missense possibly damaging 0.48
R7331:Uqcc1 UTSW 2 155911811 missense probably benign
R7548:Uqcc1 UTSW 2 155909389 missense probably damaging 1.00
R7721:Uqcc1 UTSW 2 155858146 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AAACTAGCTCCTGGTATGTCAG -3'
(R):5'- CAGAGTCCCGTGTTCTTCTG -3'

Sequencing Primer
(F):5'- GCCTCTTATCACCCACTAAGATG -3'
(R):5'- TGTAACTCCAGTTCCAGGAAGCTG -3'
Posted On2018-06-06