Incidental Mutation 'R6553:Chd1'
ID521808
Institutional Source Beutler Lab
Gene Symbol Chd1
Ensembl Gene ENSMUSG00000023852
Gene Namechromodomain helicase DNA binding protein 1
Synonyms4930525N21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6553 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location15704967-15772610 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 15725430 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 72 (N72S)
Ref Sequence ENSEMBL: ENSMUSP00000134091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024627] [ENSMUST00000173311]
Predicted Effect probably benign
Transcript: ENSMUST00000024627
AA Change: N72S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024627
Gene: ENSMUSG00000023852
AA Change: N72S

DomainStartEndE-ValueType
low complexity region 17 67 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 116 136 N/A INTRINSIC
low complexity region 151 175 N/A INTRINSIC
low complexity region 213 230 N/A INTRINSIC
CHROMO 268 355 6.43e-20 SMART
CHROMO 385 443 1.19e-14 SMART
DEXDc 475 672 3.44e-34 SMART
Blast:DEXDc 692 786 2e-54 BLAST
low complexity region 787 799 N/A INTRINSIC
HELICc 816 900 8.48e-25 SMART
Blast:DEXDc 955 1234 1e-112 BLAST
PDB:4B4C|A 1119 1320 1e-132 PDB
low complexity region 1325 1348 N/A INTRINSIC
low complexity region 1377 1388 N/A INTRINSIC
DUF4208 1396 1500 5.54e-51 SMART
low complexity region 1507 1516 N/A INTRINSIC
low complexity region 1538 1549 N/A INTRINSIC
low complexity region 1626 1650 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173159
Predicted Effect probably benign
Transcript: ENSMUST00000173311
AA Change: N72S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000134091
Gene: ENSMUSG00000023852
AA Change: N72S

DomainStartEndE-ValueType
low complexity region 17 67 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 116 136 N/A INTRINSIC
low complexity region 151 175 N/A INTRINSIC
low complexity region 213 230 N/A INTRINSIC
CHROMO 268 355 6.43e-20 SMART
CHROMO 385 443 1.19e-14 SMART
DEXDc 475 672 3.44e-34 SMART
Blast:DEXDc 692 786 2e-54 BLAST
low complexity region 787 799 N/A INTRINSIC
HELICc 816 900 8.48e-25 SMART
Blast:DEXDc 955 1078 2e-38 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with arrest of epiblast development due to increased apoptosis and cell cycle defects, abnormal rostral-caudal axis patterning, and failure to gastrulate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1b G T 5: 121,501,187 D598E probably benign Het
Ascc3 A G 10: 50,842,177 K1989E probably benign Het
Asic5 A T 3: 82,009,466 T288S possibly damaging Het
Ciita T A 16: 10,511,745 V628E probably benign Het
Cyp2c50 A G 19: 40,090,602 T130A probably benign Het
Dapk1 T A 13: 60,761,161 V1196E probably damaging Het
Dis3l2 T A 1: 86,745,494 I69N probably damaging Het
Exph5 A G 9: 53,301,712 probably benign Het
Fcgbp A T 7: 28,113,979 Q2313L possibly damaging Het
Gm2888 A G 14: 3,037,722 H238R possibly damaging Het
Gm5622 A G 14: 51,657,743 K120E probably damaging Het
Gm7534 A G 4: 134,202,056 S313P probably damaging Het
Gpr155 A T 2: 73,349,645 I157N probably damaging Het
Hltf T C 3: 20,072,394 V245A probably damaging Het
Kmt2e G A 5: 23,463,026 V28I probably damaging Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Nprl3 C T 11: 32,234,812 R399Q probably benign Het
Olfr804 C T 10: 129,705,063 R62C probably benign Het
Ptgs2 T C 1: 150,103,987 V281A possibly damaging Het
Speer4f2 A G 5: 17,374,422 E73G probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Trav13n-3 A G 14: 53,337,161 T14A probably benign Het
Trav9d-4 A T 14: 52,983,741 Q63L probably benign Het
Vmn2r75 T A 7: 86,164,245 N450Y probably benign Het
Vmn2r97 G A 17: 18,930,304 W471* probably null Het
Zfp27 G A 7: 29,896,393 T49I possibly damaging Het
Other mutations in Chd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Chd1 APN 17 15732565 missense probably benign 0.37
IGL01356:Chd1 APN 17 15749865 missense probably damaging 1.00
IGL01369:Chd1 APN 17 15754997 missense probably damaging 0.97
IGL01519:Chd1 APN 17 17378569 missense probably damaging 1.00
IGL01604:Chd1 APN 17 15770097 missense possibly damaging 0.95
IGL01635:Chd1 APN 17 17378596 missense probably damaging 1.00
IGL01721:Chd1 APN 17 15770168 missense probably damaging 1.00
IGL01959:Chd1 APN 17 15742173 missense probably damaging 1.00
IGL02367:Chd1 APN 17 17390053 missense probably damaging 0.98
IGL02476:Chd1 APN 17 15734273 missense probably damaging 1.00
IGL02756:Chd1 APN 17 15730807 missense probably damaging 0.97
IGL02817:Chd1 APN 17 15749500 missense possibly damaging 0.92
IGL03084:Chd1 APN 17 15770298 missense probably benign 0.22
IGL03108:Chd1 APN 17 15725281 missense possibly damaging 0.70
Holly UTSW 17 15726283 missense possibly damaging 0.72
R0053:Chd1 UTSW 17 15747189 missense probably damaging 1.00
R0053:Chd1 UTSW 17 15747189 missense probably damaging 1.00
R0128:Chd1 UTSW 17 17393567 missense probably damaging 1.00
R0197:Chd1 UTSW 17 15725431 missense probably benign
R0285:Chd1 UTSW 17 17374680 splice site probably benign
R0326:Chd1 UTSW 17 15768566 missense probably damaging 1.00
R0326:Chd1 UTSW 17 15768568 missense probably benign
R0372:Chd1 UTSW 17 17387290 missense probably benign 0.14
R0391:Chd1 UTSW 17 15749894 missense probably damaging 1.00
R0486:Chd1 UTSW 17 15734342 missense probably damaging 0.99
R0637:Chd1 UTSW 17 15742288 missense possibly damaging 0.50
R0675:Chd1 UTSW 17 15758261 unclassified probably benign
R0701:Chd1 UTSW 17 15725431 missense probably benign
R0788:Chd1 UTSW 17 15707114 missense possibly damaging 0.86
R0848:Chd1 UTSW 17 15770241 missense probably damaging 1.00
R0883:Chd1 UTSW 17 15725431 missense probably benign
R1169:Chd1 UTSW 17 15735732 missense probably damaging 1.00
R1218:Chd1 UTSW 17 15725312 missense probably damaging 1.00
R1370:Chd1 UTSW 17 17387480 missense probably benign 0.00
R1470:Chd1 UTSW 17 15726283 missense possibly damaging 0.72
R1470:Chd1 UTSW 17 15726283 missense possibly damaging 0.72
R1478:Chd1 UTSW 17 15739507 missense probably damaging 0.99
R1752:Chd1 UTSW 17 15743232 critical splice donor site probably null
R1759:Chd1 UTSW 17 17387271 missense probably benign 0.00
R1767:Chd1 UTSW 17 15770303 missense probably damaging 1.00
R1938:Chd1 UTSW 17 15762486 missense probably benign 0.39
R2007:Chd1 UTSW 17 15731006 missense probably damaging 1.00
R2069:Chd1 UTSW 17 15742294 missense probably damaging 1.00
R3771:Chd1 UTSW 17 17374651 missense probably damaging 1.00
R3773:Chd1 UTSW 17 17374651 missense probably damaging 1.00
R3849:Chd1 UTSW 17 15731871 missense probably damaging 1.00
R4241:Chd1 UTSW 17 15770027 nonsense probably null
R4242:Chd1 UTSW 17 15770027 nonsense probably null
R4354:Chd1 UTSW 17 17390001 missense probably benign 0.23
R4468:Chd1 UTSW 17 15760395 missense probably damaging 0.99
R4469:Chd1 UTSW 17 15760395 missense probably damaging 0.99
R4731:Chd1 UTSW 17 17377817 missense probably benign 0.36
R4824:Chd1 UTSW 17 15733124 missense probably damaging 1.00
R4840:Chd1 UTSW 17 15768753 nonsense probably null
R4840:Chd1 UTSW 17 15768754 missense probably damaging 1.00
R4880:Chd1 UTSW 17 17374654 missense probably damaging 1.00
R4960:Chd1 UTSW 17 15742231 missense probably damaging 0.96
R5071:Chd1 UTSW 17 15762405 missense probably benign
R5078:Chd1 UTSW 17 15726354 missense possibly damaging 0.93
R5114:Chd1 UTSW 17 15728198 missense probably benign 0.25
R5268:Chd1 UTSW 17 15735743 missense probably damaging 1.00
R5304:Chd1 UTSW 17 15754951 missense probably benign 0.01
R5304:Chd1 UTSW 17 15770268 missense possibly damaging 0.55
R5307:Chd1 UTSW 17 15732570 missense probably damaging 1.00
R5458:Chd1 UTSW 17 15738549 missense probably damaging 1.00
R5553:Chd1 UTSW 17 17385613 missense probably benign 0.17
R5623:Chd1 UTSW 17 15754932 missense probably damaging 1.00
R6022:Chd1 UTSW 17 17377773 missense probably benign 0.39
R6137:Chd1 UTSW 17 15758688 missense probably damaging 1.00
R6257:Chd1 UTSW 17 15730203 splice site probably null
R6373:Chd1 UTSW 17 15738636 missense probably damaging 1.00
R6458:Chd1 UTSW 17 15730602 missense probably benign 0.01
R6476:Chd1 UTSW 17 17380988 critical splice donor site probably null
R6508:Chd1 UTSW 17 15738633 missense probably benign 0.31
R6745:Chd1 UTSW 17 17387167 missense probably benign 0.08
R7107:Chd1 UTSW 17 15761366 missense probably damaging 0.98
R7230:Chd1 UTSW 17 15706937 splice site probably null
R7317:Chd1 UTSW 17 15742274 missense possibly damaging 0.71
R7341:Chd1 UTSW 17 15770237 missense probably damaging 0.99
R7421:Chd1 UTSW 17 15749398 missense probably benign 0.03
R7704:Chd1 UTSW 17 15767475 missense probably benign
R7763:Chd1 UTSW 17 15733041 missense probably damaging 1.00
R8156:Chd1 UTSW 17 15761404 missense probably benign
R8194:Chd1 UTSW 17 17374475 start gained probably benign
R8261:Chd1 UTSW 17 17387542 missense probably benign 0.02
R8338:Chd1 UTSW 17 15769980 missense probably damaging 1.00
R8401:Chd1 UTSW 17 15743211 missense probably damaging 1.00
R8411:Chd1 UTSW 17 15762449 missense probably damaging 0.98
Z1176:Chd1 UTSW 17 15766347 missense probably damaging 0.98
Z1176:Chd1 UTSW 17 15768733 missense probably damaging 1.00
Z1177:Chd1 UTSW 17 15747801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGAAGAGGTAAATTCCTGTC -3'
(R):5'- AAATCCAGAATGTCATGCGTG -3'

Sequencing Primer
(F):5'- AATTCCTGTCGAATTTTGCTCTGATG -3'
(R):5'- CCAGAATGTCATGCGTGTTAGAC -3'
Posted On2018-06-06