Incidental Mutation 'R6553:Chd1'
ID 521808
Institutional Source Beutler Lab
Gene Symbol Chd1
Ensembl Gene ENSMUSG00000023852
Gene Name chromodomain helicase DNA binding protein 1
Synonyms 4930525N21Rik
MMRRC Submission 044678-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6553 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 15925229-15992872 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 15945692 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 72 (N72S)
Ref Sequence ENSEMBL: ENSMUSP00000134091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024627] [ENSMUST00000173311]
AlphaFold P40201
Predicted Effect probably benign
Transcript: ENSMUST00000024627
AA Change: N72S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024627
Gene: ENSMUSG00000023852
AA Change: N72S

DomainStartEndE-ValueType
low complexity region 17 67 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 116 136 N/A INTRINSIC
low complexity region 151 175 N/A INTRINSIC
low complexity region 213 230 N/A INTRINSIC
CHROMO 268 355 6.43e-20 SMART
CHROMO 385 443 1.19e-14 SMART
DEXDc 475 672 3.44e-34 SMART
Blast:DEXDc 692 786 2e-54 BLAST
low complexity region 787 799 N/A INTRINSIC
HELICc 816 900 8.48e-25 SMART
Blast:DEXDc 955 1234 1e-112 BLAST
PDB:4B4C|A 1119 1320 1e-132 PDB
low complexity region 1325 1348 N/A INTRINSIC
low complexity region 1377 1388 N/A INTRINSIC
DUF4208 1396 1500 5.54e-51 SMART
low complexity region 1507 1516 N/A INTRINSIC
low complexity region 1538 1549 N/A INTRINSIC
low complexity region 1626 1650 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173159
Predicted Effect probably benign
Transcript: ENSMUST00000173311
AA Change: N72S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000134091
Gene: ENSMUSG00000023852
AA Change: N72S

DomainStartEndE-ValueType
low complexity region 17 67 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 116 136 N/A INTRINSIC
low complexity region 151 175 N/A INTRINSIC
low complexity region 213 230 N/A INTRINSIC
CHROMO 268 355 6.43e-20 SMART
CHROMO 385 443 1.19e-14 SMART
DEXDc 475 672 3.44e-34 SMART
Blast:DEXDc 692 786 2e-54 BLAST
low complexity region 787 799 N/A INTRINSIC
HELICc 816 900 8.48e-25 SMART
Blast:DEXDc 955 1078 2e-38 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with arrest of epiblast development due to increased apoptosis and cell cycle defects, abnormal rostral-caudal axis patterning, and failure to gastrulate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1b G T 5: 121,639,250 (GRCm39) D598E probably benign Het
Ascc3 A G 10: 50,718,273 (GRCm39) K1989E probably benign Het
Asic5 A T 3: 81,916,773 (GRCm39) T288S possibly damaging Het
Ciita T A 16: 10,329,609 (GRCm39) V628E probably benign Het
Cyp2c50 A G 19: 40,079,046 (GRCm39) T130A probably benign Het
Dapk1 T A 13: 60,908,975 (GRCm39) V1196E probably damaging Het
Dis3l2 T A 1: 86,673,216 (GRCm39) I69N probably damaging Het
Exph5 A G 9: 53,213,012 (GRCm39) probably benign Het
Fcgbp A T 7: 27,813,404 (GRCm39) Q2313L possibly damaging Het
Gm2888 A G 14: 3,037,722 (GRCm38) H238R possibly damaging Het
Gm5622 A G 14: 51,895,200 (GRCm39) K120E probably damaging Het
Gpr155 A T 2: 73,179,989 (GRCm39) I157N probably damaging Het
Hltf T C 3: 20,126,558 (GRCm39) V245A probably damaging Het
Kmt2e G A 5: 23,668,024 (GRCm39) V28I probably damaging Het
Lsm3 GATATATA GATATATATA 6: 91,496,617 (GRCm39) probably null Het
Nprl3 C T 11: 32,184,812 (GRCm39) R399Q probably benign Het
Or6c6c C T 10: 129,540,932 (GRCm39) R62C probably benign Het
Ptgs2 T C 1: 149,979,738 (GRCm39) V281A possibly damaging Het
Speer4f2 A G 5: 17,579,420 (GRCm39) E73G probably damaging Het
Tmem161b C A 13: 84,370,537 (GRCm39) probably benign Het
Trav13n-3 A G 14: 53,574,618 (GRCm39) T14A probably benign Het
Trav9d-4 A T 14: 53,221,198 (GRCm39) Q63L probably benign Het
Vmn2r75 T A 7: 85,813,453 (GRCm39) N450Y probably benign Het
Vmn2r97 G A 17: 19,150,566 (GRCm39) W471* probably null Het
Zfp27 G A 7: 29,595,818 (GRCm39) T49I possibly damaging Het
Zpld2 A G 4: 133,929,367 (GRCm39) S313P probably damaging Het
Other mutations in Chd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Chd1 APN 17 15,952,827 (GRCm39) missense probably benign 0.37
IGL01356:Chd1 APN 17 15,970,127 (GRCm39) missense probably damaging 1.00
IGL01369:Chd1 APN 17 15,975,259 (GRCm39) missense probably damaging 0.97
IGL01519:Chd1 APN 17 17,598,831 (GRCm39) missense probably damaging 1.00
IGL01604:Chd1 APN 17 15,990,359 (GRCm39) missense possibly damaging 0.95
IGL01635:Chd1 APN 17 17,598,858 (GRCm39) missense probably damaging 1.00
IGL01721:Chd1 APN 17 15,990,430 (GRCm39) missense probably damaging 1.00
IGL01959:Chd1 APN 17 15,962,435 (GRCm39) missense probably damaging 1.00
IGL02367:Chd1 APN 17 17,610,315 (GRCm39) missense probably damaging 0.98
IGL02476:Chd1 APN 17 15,954,535 (GRCm39) missense probably damaging 1.00
IGL02756:Chd1 APN 17 15,951,069 (GRCm39) missense probably damaging 0.97
IGL02817:Chd1 APN 17 15,969,762 (GRCm39) missense possibly damaging 0.92
IGL03084:Chd1 APN 17 15,990,560 (GRCm39) missense probably benign 0.22
IGL03108:Chd1 APN 17 15,945,543 (GRCm39) missense possibly damaging 0.70
Holly UTSW 17 15,946,545 (GRCm39) missense possibly damaging 0.72
R0053:Chd1 UTSW 17 15,967,451 (GRCm39) missense probably damaging 1.00
R0053:Chd1 UTSW 17 15,967,451 (GRCm39) missense probably damaging 1.00
R0128:Chd1 UTSW 17 17,613,829 (GRCm39) missense probably damaging 1.00
R0197:Chd1 UTSW 17 15,945,693 (GRCm39) missense probably benign
R0285:Chd1 UTSW 17 17,594,942 (GRCm39) splice site probably benign
R0326:Chd1 UTSW 17 15,988,830 (GRCm39) missense probably benign
R0326:Chd1 UTSW 17 15,988,828 (GRCm39) missense probably damaging 1.00
R0372:Chd1 UTSW 17 17,607,552 (GRCm39) missense probably benign 0.14
R0391:Chd1 UTSW 17 15,970,156 (GRCm39) missense probably damaging 1.00
R0486:Chd1 UTSW 17 15,954,604 (GRCm39) missense probably damaging 0.99
R0637:Chd1 UTSW 17 15,962,550 (GRCm39) missense possibly damaging 0.50
R0675:Chd1 UTSW 17 15,978,523 (GRCm39) unclassified probably benign
R0701:Chd1 UTSW 17 15,945,693 (GRCm39) missense probably benign
R0788:Chd1 UTSW 17 15,927,376 (GRCm39) missense possibly damaging 0.86
R0848:Chd1 UTSW 17 15,990,503 (GRCm39) missense probably damaging 1.00
R0883:Chd1 UTSW 17 15,945,693 (GRCm39) missense probably benign
R1169:Chd1 UTSW 17 15,955,994 (GRCm39) missense probably damaging 1.00
R1218:Chd1 UTSW 17 15,945,574 (GRCm39) missense probably damaging 1.00
R1370:Chd1 UTSW 17 17,607,742 (GRCm39) missense probably benign 0.00
R1470:Chd1 UTSW 17 15,946,545 (GRCm39) missense possibly damaging 0.72
R1470:Chd1 UTSW 17 15,946,545 (GRCm39) missense possibly damaging 0.72
R1478:Chd1 UTSW 17 15,959,769 (GRCm39) missense probably damaging 0.99
R1752:Chd1 UTSW 17 15,963,494 (GRCm39) critical splice donor site probably null
R1759:Chd1 UTSW 17 17,607,533 (GRCm39) missense probably benign 0.00
R1767:Chd1 UTSW 17 15,990,565 (GRCm39) missense probably damaging 1.00
R1938:Chd1 UTSW 17 15,982,748 (GRCm39) missense probably benign 0.39
R2007:Chd1 UTSW 17 15,951,268 (GRCm39) missense probably damaging 1.00
R2069:Chd1 UTSW 17 15,962,556 (GRCm39) missense probably damaging 1.00
R3771:Chd1 UTSW 17 17,594,913 (GRCm39) missense probably damaging 1.00
R3773:Chd1 UTSW 17 17,594,913 (GRCm39) missense probably damaging 1.00
R3849:Chd1 UTSW 17 15,952,133 (GRCm39) missense probably damaging 1.00
R4241:Chd1 UTSW 17 15,990,289 (GRCm39) nonsense probably null
R4242:Chd1 UTSW 17 15,990,289 (GRCm39) nonsense probably null
R4354:Chd1 UTSW 17 17,610,263 (GRCm39) missense probably benign 0.23
R4468:Chd1 UTSW 17 15,980,657 (GRCm39) missense probably damaging 0.99
R4469:Chd1 UTSW 17 15,980,657 (GRCm39) missense probably damaging 0.99
R4731:Chd1 UTSW 17 17,598,079 (GRCm39) missense probably benign 0.36
R4824:Chd1 UTSW 17 15,953,386 (GRCm39) missense probably damaging 1.00
R4840:Chd1 UTSW 17 15,989,016 (GRCm39) missense probably damaging 1.00
R4840:Chd1 UTSW 17 15,989,015 (GRCm39) nonsense probably null
R4880:Chd1 UTSW 17 17,594,916 (GRCm39) missense probably damaging 1.00
R4960:Chd1 UTSW 17 15,962,493 (GRCm39) missense probably damaging 0.96
R5071:Chd1 UTSW 17 15,982,667 (GRCm39) missense probably benign
R5078:Chd1 UTSW 17 15,946,616 (GRCm39) missense possibly damaging 0.93
R5114:Chd1 UTSW 17 15,948,460 (GRCm39) missense probably benign 0.25
R5268:Chd1 UTSW 17 15,956,005 (GRCm39) missense probably damaging 1.00
R5304:Chd1 UTSW 17 15,990,530 (GRCm39) missense possibly damaging 0.55
R5304:Chd1 UTSW 17 15,975,213 (GRCm39) missense probably benign 0.01
R5307:Chd1 UTSW 17 15,952,832 (GRCm39) missense probably damaging 1.00
R5458:Chd1 UTSW 17 15,958,811 (GRCm39) missense probably damaging 1.00
R5553:Chd1 UTSW 17 17,605,875 (GRCm39) missense probably benign 0.17
R5623:Chd1 UTSW 17 15,975,194 (GRCm39) missense probably damaging 1.00
R6022:Chd1 UTSW 17 17,598,035 (GRCm39) missense probably benign 0.39
R6137:Chd1 UTSW 17 15,978,950 (GRCm39) missense probably damaging 1.00
R6257:Chd1 UTSW 17 15,950,465 (GRCm39) splice site probably null
R6373:Chd1 UTSW 17 15,958,898 (GRCm39) missense probably damaging 1.00
R6458:Chd1 UTSW 17 15,950,864 (GRCm39) missense probably benign 0.01
R6476:Chd1 UTSW 17 17,601,250 (GRCm39) critical splice donor site probably null
R6508:Chd1 UTSW 17 15,958,895 (GRCm39) missense probably benign 0.31
R6745:Chd1 UTSW 17 17,607,429 (GRCm39) missense probably benign 0.08
R7107:Chd1 UTSW 17 15,981,628 (GRCm39) missense probably damaging 0.98
R7230:Chd1 UTSW 17 15,927,199 (GRCm39) splice site probably null
R7317:Chd1 UTSW 17 15,962,536 (GRCm39) missense possibly damaging 0.71
R7341:Chd1 UTSW 17 15,990,499 (GRCm39) missense probably damaging 0.99
R7421:Chd1 UTSW 17 15,969,660 (GRCm39) missense probably benign 0.03
R7704:Chd1 UTSW 17 15,987,737 (GRCm39) missense probably benign
R7763:Chd1 UTSW 17 15,953,303 (GRCm39) missense probably damaging 1.00
R8156:Chd1 UTSW 17 15,981,666 (GRCm39) missense probably benign
R8194:Chd1 UTSW 17 17,594,737 (GRCm39) start gained probably benign
R8261:Chd1 UTSW 17 17,607,804 (GRCm39) missense probably benign 0.02
R8338:Chd1 UTSW 17 15,990,242 (GRCm39) missense probably damaging 1.00
R8401:Chd1 UTSW 17 15,963,473 (GRCm39) missense probably damaging 1.00
R8411:Chd1 UTSW 17 15,982,711 (GRCm39) missense probably damaging 0.98
R9067:Chd1 UTSW 17 15,951,107 (GRCm39) missense possibly damaging 0.49
R9184:Chd1 UTSW 17 15,962,551 (GRCm39) missense possibly damaging 0.71
R9210:Chd1 UTSW 17 15,950,767 (GRCm39) missense possibly damaging 0.70
R9212:Chd1 UTSW 17 15,950,767 (GRCm39) missense possibly damaging 0.70
R9666:Chd1 UTSW 17 15,955,976 (GRCm39) missense probably damaging 1.00
R9673:Chd1 UTSW 17 15,989,023 (GRCm39) missense probably benign 0.24
Z1176:Chd1 UTSW 17 15,988,995 (GRCm39) missense probably damaging 1.00
Z1176:Chd1 UTSW 17 15,986,609 (GRCm39) missense probably damaging 0.98
Z1177:Chd1 UTSW 17 15,968,063 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGAAGAGGTAAATTCCTGTC -3'
(R):5'- AAATCCAGAATGTCATGCGTG -3'

Sequencing Primer
(F):5'- AATTCCTGTCGAATTTTGCTCTGATG -3'
(R):5'- CCAGAATGTCATGCGTGTTAGAC -3'
Posted On 2018-06-06