Incidental Mutation 'R6553:Vmn2r97'
ID 521809
Institutional Source Beutler Lab
Gene Symbol Vmn2r97
Ensembl Gene ENSMUSG00000091491
Gene Name vomeronasal 2, receptor 97
Synonyms EG627367
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock # R6553 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 18914300-18958087 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 18930304 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 471 (W471*)
Ref Sequence ENSEMBL: ENSMUSP00000156141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168710] [ENSMUST00000232219]
AlphaFold K7N6Z2
Predicted Effect probably null
Transcript: ENSMUST00000168710
AA Change: W471*
SMART Domains Protein: ENSMUSP00000129313
Gene: ENSMUSG00000091491
AA Change: W471*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 82 442 2.9e-36 PFAM
Pfam:NCD3G 513 566 4.9e-21 PFAM
Pfam:7tm_3 599 834 1.7e-52 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000232219
AA Change: W471*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232325
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1b G T 5: 121,501,187 D598E probably benign Het
Ascc3 A G 10: 50,842,177 K1989E probably benign Het
Asic5 A T 3: 82,009,466 T288S possibly damaging Het
Chd1 A G 17: 15,725,430 N72S probably benign Het
Ciita T A 16: 10,511,745 V628E probably benign Het
Cyp2c50 A G 19: 40,090,602 T130A probably benign Het
Dapk1 T A 13: 60,761,161 V1196E probably damaging Het
Dis3l2 T A 1: 86,745,494 I69N probably damaging Het
Exph5 A G 9: 53,301,712 probably benign Het
Fcgbp A T 7: 28,113,979 Q2313L possibly damaging Het
Gm2888 A G 14: 3,037,722 H238R possibly damaging Het
Gm5622 A G 14: 51,657,743 K120E probably damaging Het
Gm7534 A G 4: 134,202,056 S313P probably damaging Het
Gpr155 A T 2: 73,349,645 I157N probably damaging Het
Hltf T C 3: 20,072,394 V245A probably damaging Het
Kmt2e G A 5: 23,463,026 V28I probably damaging Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Nprl3 C T 11: 32,234,812 R399Q probably benign Het
Olfr804 C T 10: 129,705,063 R62C probably benign Het
Ptgs2 T C 1: 150,103,987 V281A possibly damaging Het
Speer4f2 A G 5: 17,374,422 E73G probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Trav13n-3 A G 14: 53,337,161 T14A probably benign Het
Trav9d-4 A T 14: 52,983,741 Q63L probably benign Het
Vmn2r75 T A 7: 86,164,245 N450Y probably benign Het
Zfp27 G A 7: 29,896,393 T49I possibly damaging Het
Other mutations in Vmn2r97
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r97 APN 17 18947659 missense probably benign 0.37
IGL00962:Vmn2r97 APN 17 18929228 missense probably damaging 1.00
IGL01704:Vmn2r97 APN 17 18947811 missense probably damaging 0.99
IGL01888:Vmn2r97 APN 17 18929024 nonsense probably null
IGL02429:Vmn2r97 APN 17 18930334 missense possibly damaging 0.94
IGL02742:Vmn2r97 APN 17 18929170 missense probably damaging 0.97
IGL02934:Vmn2r97 APN 17 18929685 missense probably benign 0.00
IGL02978:Vmn2r97 APN 17 18948036 missense probably benign 0.01
IGL03230:Vmn2r97 APN 17 18929406 missense probably benign 0.10
IGL03241:Vmn2r97 APN 17 18928176 missense probably benign 0.11
IGL03050:Vmn2r97 UTSW 17 18947638 missense possibly damaging 0.84
PIT4469001:Vmn2r97 UTSW 17 18929616 missense probably benign 0.00
R0482:Vmn2r97 UTSW 17 18947668 missense probably damaging 1.00
R0514:Vmn2r97 UTSW 17 18914472 missense probably benign 0.25
R0944:Vmn2r97 UTSW 17 18947403 missense probably benign 0.13
R1061:Vmn2r97 UTSW 17 18928178 nonsense probably null
R1546:Vmn2r97 UTSW 17 18947848 missense probably damaging 1.00
R1725:Vmn2r97 UTSW 17 18929135 missense probably benign 0.43
R1860:Vmn2r97 UTSW 17 18947386 missense probably benign 0.01
R1938:Vmn2r97 UTSW 17 18929331 missense probably benign 0.01
R1944:Vmn2r97 UTSW 17 18940238 missense probably benign 0.00
R2027:Vmn2r97 UTSW 17 18929682 missense unknown
R2106:Vmn2r97 UTSW 17 18947838 missense probably damaging 1.00
R2151:Vmn2r97 UTSW 17 18947322 nonsense probably null
R2153:Vmn2r97 UTSW 17 18947322 nonsense probably null
R2154:Vmn2r97 UTSW 17 18947322 nonsense probably null
R2516:Vmn2r97 UTSW 17 18947552 missense probably benign
R3739:Vmn2r97 UTSW 17 18928151 missense probably damaging 1.00
R3744:Vmn2r97 UTSW 17 18929628 missense probably benign
R3885:Vmn2r97 UTSW 17 18928334 missense possibly damaging 0.90
R3899:Vmn2r97 UTSW 17 18947611 missense probably damaging 0.96
R4115:Vmn2r97 UTSW 17 18928070 missense probably benign 0.01
R4247:Vmn2r97 UTSW 17 18947280 missense possibly damaging 0.83
R4287:Vmn2r97 UTSW 17 18948075 intron probably benign
R4439:Vmn2r97 UTSW 17 18930354 missense probably benign 0.00
R4523:Vmn2r97 UTSW 17 18929071 missense probably benign 0.03
R4783:Vmn2r97 UTSW 17 18929288 missense probably benign
R4948:Vmn2r97 UTSW 17 18947299 missense possibly damaging 0.95
R4981:Vmn2r97 UTSW 17 18940174 nonsense probably null
R5029:Vmn2r97 UTSW 17 18947911 missense probably damaging 1.00
R5200:Vmn2r97 UTSW 17 18928353 missense probably damaging 1.00
R5541:Vmn2r97 UTSW 17 18928355 nonsense probably null
R5637:Vmn2r97 UTSW 17 18947366 nonsense probably null
R5765:Vmn2r97 UTSW 17 18947180 nonsense probably null
R5885:Vmn2r97 UTSW 17 18947773 missense possibly damaging 0.50
R6272:Vmn2r97 UTSW 17 18947599 missense possibly damaging 0.70
R6818:Vmn2r97 UTSW 17 18947931 missense possibly damaging 0.95
R6880:Vmn2r97 UTSW 17 18914508 missense probably benign 0.00
R7012:Vmn2r97 UTSW 17 18947494 missense probably damaging 0.99
R7023:Vmn2r97 UTSW 17 18914401 missense probably damaging 1.00
R7044:Vmn2r97 UTSW 17 18914367 missense probably benign 0.05
R7191:Vmn2r97 UTSW 17 18930286 missense probably damaging 1.00
R7503:Vmn2r97 UTSW 17 18928208 missense probably benign
R7862:Vmn2r97 UTSW 17 18947154 missense probably damaging 1.00
R7876:Vmn2r97 UTSW 17 18929064 missense probably damaging 0.97
R7890:Vmn2r97 UTSW 17 18929540 missense probably benign 0.00
R7936:Vmn2r97 UTSW 17 18930400 missense probably damaging 1.00
R7978:Vmn2r97 UTSW 17 18947592 missense probably damaging 1.00
R8405:Vmn2r97 UTSW 17 18914540 critical splice donor site probably null
R8755:Vmn2r97 UTSW 17 18947842 missense probably damaging 1.00
R8790:Vmn2r97 UTSW 17 18940210 missense probably damaging 1.00
R8850:Vmn2r97 UTSW 17 18929345 missense probably benign 0.00
R9060:Vmn2r97 UTSW 17 18914323 start codon destroyed probably null 0.94
R9079:Vmn2r97 UTSW 17 18929378 missense probably benign
R9252:Vmn2r97 UTSW 17 18947587 missense probably benign 0.00
R9278:Vmn2r97 UTSW 17 18914500 missense probably benign 0.00
R9342:Vmn2r97 UTSW 17 18929106 missense probably benign
R9422:Vmn2r97 UTSW 17 18929071 missense probably benign 0.03
R9496:Vmn2r97 UTSW 17 18928965 missense probably damaging 1.00
R9571:Vmn2r97 UTSW 17 18929657 missense probably benign
R9601:Vmn2r97 UTSW 17 18914508 missense probably benign
R9672:Vmn2r97 UTSW 17 18929180 missense probably benign 0.00
R9773:Vmn2r97 UTSW 17 18947959 missense probably benign 0.01
R9795:Vmn2r97 UTSW 17 18947299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTTCTACGTTTTCACTTGAAGAC -3'
(R):5'- CTCCAAGTGTAATGAAACTTGAGTC -3'

Sequencing Primer
(F):5'- GCTATTCTGTATAGTCAGGTTTTCAC -3'
(R):5'- GTGTAATGAAACTTGAGTCAATCATC -3'
Posted On 2018-06-06