Incidental Mutation 'R6526:Trmt13'
ID521810
Institutional Source Beutler Lab
Gene Symbol Trmt13
Ensembl Gene ENSMUSG00000033439
Gene NametRNA methyltransferase 13
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R6526 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location116581093-116614587 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116592215 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 31 (N31I)
Ref Sequence ENSEMBL: ENSMUSP00000143637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029571] [ENSMUST00000041524] [ENSMUST00000134761] [ENSMUST00000183638] [ENSMUST00000184963] [ENSMUST00000197190] [ENSMUST00000197335] [ENSMUST00000198311] [ENSMUST00000198386] [ENSMUST00000198454]
Predicted Effect probably benign
Transcript: ENSMUST00000029571
SMART Domains Protein: ENSMUSP00000029571
Gene: ENSMUSG00000027959

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:SAS-6_N 44 141 1.7e-29 PFAM
low complexity region 223 235 N/A INTRINSIC
coiled coil region 415 471 N/A INTRINSIC
low complexity region 632 644 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000041524
AA Change: N80I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047320
Gene: ENSMUSG00000033439
AA Change: N80I

DomainStartEndE-ValueType
Pfam:zf-TRM13_CCCH 17 45 7.2e-17 PFAM
Pfam:zf-U11-48K 56 80 3.4e-12 PFAM
Pfam:TRM13 165 469 7e-96 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124807
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126546
Predicted Effect probably damaging
Transcript: ENSMUST00000134761
AA Change: N41I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138761
Gene: ENSMUSG00000033439
AA Change: N41I

DomainStartEndE-ValueType
Pfam:zf-U11-48K 16 42 1.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156161
Predicted Effect probably damaging
Transcript: ENSMUST00000183638
AA Change: N80I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139223
Gene: ENSMUSG00000033439
AA Change: N80I

DomainStartEndE-ValueType
Pfam:zf-TRM13_CCCH 16 46 1.4e-17 PFAM
Pfam:zf-U11-48K 55 81 1.2e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000184963
AA Change: N80I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138868
Gene: ENSMUSG00000033439
AA Change: N80I

DomainStartEndE-ValueType
Pfam:zf-TRM13_CCCH 16 46 2.9e-17 PFAM
Pfam:zf-U11-48K 55 81 2.3e-12 PFAM
Pfam:TRM13 165 285 3.4e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000197190
AA Change: N31I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143637
Gene: ENSMUSG00000033439
AA Change: N31I

DomainStartEndE-ValueType
Pfam:TRM13 116 179 5.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197335
SMART Domains Protein: ENSMUSP00000143123
Gene: ENSMUSG00000027959

DomainStartEndE-ValueType
PDB:2Y3W|C 7 136 3e-48 PDB
low complexity region 188 200 N/A INTRINSIC
coiled coil region 380 436 N/A INTRINSIC
low complexity region 597 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198311
SMART Domains Protein: ENSMUSP00000143233
Gene: ENSMUSG00000027959

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
PDB:2Y3W|C 15 171 9e-62 PDB
low complexity region 223 235 N/A INTRINSIC
coiled coil region 415 471 N/A INTRINSIC
low complexity region 632 644 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198514
Predicted Effect probably benign
Transcript: ENSMUST00000198386
SMART Domains Protein: ENSMUSP00000143175
Gene: ENSMUSG00000027959

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
PDB:2Y3W|C 15 171 1e-62 PDB
low complexity region 223 235 N/A INTRINSIC
coiled coil region 415 471 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198454
SMART Domains Protein: ENSMUSP00000142410
Gene: ENSMUSG00000033439

DomainStartEndE-ValueType
Pfam:zf-TRM13_CCCH 16 46 1.9e-14 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,284,172 probably null Het
Abcc3 C T 11: 94,359,372 G975D probably benign Het
Abhd13 G A 8: 9,987,777 G125S probably damaging Het
Ache T A 5: 137,290,644 L204Q probably damaging Het
Acnat2 A G 4: 49,383,497 S19P probably benign Het
Adprh A G 16: 38,447,276 Y216H probably benign Het
Anapc1 T A 2: 128,672,135 K429* probably null Het
Anxa13 T C 15: 58,344,957 noncoding transcript Het
Aprt A C 8: 122,576,816 L6W probably damaging Het
Arhgef15 T C 11: 68,949,994 T569A probably damaging Het
Atp11a T C 8: 12,864,999 L1139P probably benign Het
Atp2b4 A G 1: 133,711,729 S1136P probably damaging Het
B9d1 T A 11: 61,509,097 Y90* probably null Het
Btla G A 16: 45,239,094 A54T probably damaging Het
Cd63 T C 10: 128,911,489 V35A probably benign Het
Chek2 T C 5: 110,848,690 F173L probably damaging Het
Cntnap3 T A 13: 64,781,888 N499I possibly damaging Het
Cog4 T C 8: 110,881,786 L738P probably damaging Het
Cops6 T C 5: 138,163,900 probably null Het
Cpeb1 T A 7: 81,361,669 I175F probably benign Het
Cyp3a16 C T 5: 145,455,895 D174N probably benign Het
Dnah6 T G 6: 73,074,704 I2984L probably benign Het
Dock10 A T 1: 80,586,351 I540N probably damaging Het
Elf5 A G 2: 103,439,233 Y53C probably damaging Het
Elmod2 T C 8: 83,319,457 T164A probably damaging Het
Epn3 A G 11: 94,494,932 probably null Het
Fam151a A T 4: 106,734,004 I15F possibly damaging Het
Gm11115 T A 5: 88,154,050 probably null Het
Gm13103 A G 4: 143,852,814 D323G probably damaging Het
Golga3 T A 5: 110,204,895 I884N probably damaging Het
Gria2 A T 3: 80,692,469 F703I probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gtpbp2 A T 17: 46,164,111 probably null Het
Herc2 T C 7: 56,157,330 S2419P probably damaging Het
Ikbkap T C 4: 56,798,812 probably null Het
Inpp5d T C 1: 87,676,250 probably benign Het
Kdm2b C A 5: 122,961,469 V136F probably damaging Het
Klra2 T A 6: 131,221,876 D234V probably benign Het
Lct A T 1: 128,300,478 S1093T probably benign Het
March9 A G 10: 127,056,689 L310P probably benign Het
Morc1 G T 16: 48,587,124 E668* probably null Het
Mum1 A G 10: 80,232,279 T86A probably benign Het
Nbas A T 12: 13,405,425 L1213F probably damaging Het
Neto1 A G 18: 86,498,748 T397A possibly damaging Het
Oit3 A G 10: 59,429,640 C268R probably damaging Het
Olfr476 A G 7: 107,967,462 T22A probably benign Het
Pcx T C 19: 4,604,495 F312L probably benign Het
Pitx2 T C 3: 129,214,783 probably null Het
Pkhd1l1 G A 15: 44,498,089 probably null Het
Polr1a C A 6: 71,929,443 D414E possibly damaging Het
Prkch T C 12: 73,702,775 Y381H probably damaging Het
Ptger3 T A 3: 157,567,502 V162E probably damaging Het
Ptgr2 T G 12: 84,313,952 M332R probably damaging Het
Ptprq G T 10: 107,542,653 S2009* probably null Het
Rangrf C T 11: 68,973,688 G11R probably damaging Het
Rbl2 A T 8: 91,096,839 Q465L probably benign Het
Rhbdd1 A T 1: 82,340,659 M88L probably benign Het
Setd2 G A 9: 110,532,717 M13I probably benign Het
Sirpb1a T C 3: 15,379,020 Y384C probably damaging Het
Slc13a1 C T 6: 24,097,612 G439S probably damaging Het
Slc41a1 T A 1: 131,841,149 I239N probably damaging Het
Slit2 T A 5: 48,304,167 C1502S probably damaging Het
Slit3 G A 11: 35,661,292 E888K probably benign Het
Srrm3 G T 5: 135,835,234 R62L probably damaging Het
Synm A G 7: 67,735,583 V777A possibly damaging Het
Trpm8 G A 1: 88,361,998 E893K probably damaging Het
Uqcc1 A G 2: 155,851,423 F197S probably damaging Het
Vmn1r67 T A 7: 10,447,671 N287K probably benign Het
Vmn2r44 A T 7: 8,378,099 M265K probably benign Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xdh C A 17: 73,900,551 C937F probably damaging Het
Zfp846 T A 9: 20,593,871 N342K probably benign Het
Other mutations in Trmt13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Trmt13 APN 3 116590235 nonsense probably null
IGL01516:Trmt13 APN 3 116589810 unclassified probably benign
IGL01732:Trmt13 APN 3 116581464 missense probably damaging 1.00
IGL01783:Trmt13 APN 3 116582912 nonsense probably null
IGL02470:Trmt13 APN 3 116590228 critical splice donor site probably null
IGL02492:Trmt13 APN 3 116582543 missense possibly damaging 0.53
IGL02531:Trmt13 APN 3 116592191 critical splice donor site probably null
IGL03156:Trmt13 APN 3 116585802 missense probably benign 0.00
R0394:Trmt13 UTSW 3 116582650 missense probably damaging 1.00
R0446:Trmt13 UTSW 3 116582626 missense probably damaging 1.00
R2211:Trmt13 UTSW 3 116594754 missense probably benign 0.00
R2942:Trmt13 UTSW 3 116585772 missense probably damaging 1.00
R3124:Trmt13 UTSW 3 116590244 missense probably benign 0.00
R3945:Trmt13 UTSW 3 116581518 missense probably damaging 1.00
R3946:Trmt13 UTSW 3 116581518 missense probably damaging 1.00
R4255:Trmt13 UTSW 3 116582688 nonsense probably null
R4520:Trmt13 UTSW 3 116581613 splice site probably null
R4609:Trmt13 UTSW 3 116594827 utr 5 prime probably benign
R4678:Trmt13 UTSW 3 116589755 missense probably damaging 1.00
R4679:Trmt13 UTSW 3 116589755 missense probably damaging 1.00
R4703:Trmt13 UTSW 3 116594598 missense probably benign 0.00
R7064:Trmt13 UTSW 3 116582697 missense probably damaging 1.00
R7079:Trmt13 UTSW 3 116582831 missense probably benign 0.00
R7308:Trmt13 UTSW 3 116594739 missense probably benign 0.09
R8347:Trmt13 UTSW 3 116582768 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGCCTAAGTAATGCAGCAC -3'
(R):5'- CTCGGAAAAGAATCTTGTGTCC -3'

Sequencing Primer
(F):5'- TGGGCTACACAGTGTAACCTG -3'
(R):5'- CGGAAAAGAATCTTGTGTCCTTTAG -3'
Posted On2018-06-06