Incidental Mutation 'R6526:Pitx2'
ID521812
Institutional Source Beutler Lab
Gene Symbol Pitx2
Ensembl Gene ENSMUSG00000028023
Gene Namepaired-like homeodomain transcription factor 2
SynonymsPitx2b, Pitx2a, Brx1, solurshin, Brx1a, Brx1b, Ptx2, Otlx2, Pitx2c, Rieg, Munc30
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6526 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location129199878-129219591 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 129214783 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029657] [ENSMUST00000042587] [ENSMUST00000106382] [ENSMUST00000172645] [ENSMUST00000174623] [ENSMUST00000174661]
Predicted Effect probably benign
Transcript: ENSMUST00000029657
Predicted Effect probably null
Transcript: ENSMUST00000042587
SMART Domains Protein: ENSMUSP00000047359
Gene: ENSMUSG00000028023

DomainStartEndE-ValueType
HOX 92 154 6.5e-26 SMART
low complexity region 213 236 N/A INTRINSIC
low complexity region 244 262 N/A INTRINSIC
low complexity region 263 280 N/A INTRINSIC
Pfam:OAR 282 300 4.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106382
SMART Domains Protein: ENSMUSP00000101990
Gene: ENSMUSG00000028023

DomainStartEndE-ValueType
HOX 39 101 6.5e-26 SMART
low complexity region 160 183 N/A INTRINSIC
low complexity region 191 209 N/A INTRINSIC
low complexity region 210 227 N/A INTRINSIC
Pfam:OAR 228 248 2.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172645
SMART Domains Protein: ENSMUSP00000134692
Gene: ENSMUSG00000028023

DomainStartEndE-ValueType
HOX 72 134 6.5e-26 SMART
low complexity region 193 216 N/A INTRINSIC
low complexity region 224 242 N/A INTRINSIC
low complexity region 243 260 N/A INTRINSIC
Pfam:OAR 262 280 9.5e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174623
SMART Domains Protein: ENSMUSP00000139328
Gene: ENSMUSG00000028023

DomainStartEndE-ValueType
HOX 92 151 1.37e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174661
SMART Domains Protein: ENSMUSP00000133756
Gene: ENSMUSG00000028023

DomainStartEndE-ValueType
HOX 85 147 6.5e-26 SMART
low complexity region 206 229 N/A INTRINSIC
low complexity region 237 255 N/A INTRINSIC
low complexity region 256 273 N/A INTRINSIC
Pfam:OAR 274 294 1.8e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187145
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RIEG/PITX homeobox family, which is in the bicoid class of homeodomain proteins. The encoded protein acts as a transcription factor and regulates procollagen lysyl hydroxylase gene expression. This protein plays a role in the terminal differentiation of somatotroph and lactotroph cell phenotypes, is involved in the development of the eye, tooth and abdominal organs, and acts as a transcriptional regulator involved in basal and hormone-regulated activity of prolactin. Mutations in this gene are associated with Axenfeld-Rieger syndrome, iridogoniodysgenesis syndrome, and sporadic cases of Peters anomaly. A similar protein in other vertebrates is involved in the determination of left-right asymmetry during development. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations show failed ventral body wall closure, right pulmonary isomerism, septal and valve defects, absent ocular muscles, arrested pituitary and tooth development, optic nerve, mandible and maxilla defects, and embryonic death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,284,172 probably null Het
Abcc3 C T 11: 94,359,372 G975D probably benign Het
Abhd13 G A 8: 9,987,777 G125S probably damaging Het
Ache T A 5: 137,290,644 L204Q probably damaging Het
Acnat2 A G 4: 49,383,497 S19P probably benign Het
Adprh A G 16: 38,447,276 Y216H probably benign Het
Anapc1 T A 2: 128,672,135 K429* probably null Het
Anxa13 T C 15: 58,344,957 noncoding transcript Het
Aprt A C 8: 122,576,816 L6W probably damaging Het
Arhgef15 T C 11: 68,949,994 T569A probably damaging Het
Atp11a T C 8: 12,864,999 L1139P probably benign Het
Atp2b4 A G 1: 133,711,729 S1136P probably damaging Het
B9d1 T A 11: 61,509,097 Y90* probably null Het
Btla G A 16: 45,239,094 A54T probably damaging Het
Cd63 T C 10: 128,911,489 V35A probably benign Het
Chek2 T C 5: 110,848,690 F173L probably damaging Het
Cntnap3 T A 13: 64,781,888 N499I possibly damaging Het
Cog4 T C 8: 110,881,786 L738P probably damaging Het
Cops6 T C 5: 138,163,900 probably null Het
Cpeb1 T A 7: 81,361,669 I175F probably benign Het
Cyp3a16 C T 5: 145,455,895 D174N probably benign Het
Dnah6 T G 6: 73,074,704 I2984L probably benign Het
Dock10 A T 1: 80,586,351 I540N probably damaging Het
Elf5 A G 2: 103,439,233 Y53C probably damaging Het
Elmod2 T C 8: 83,319,457 T164A probably damaging Het
Epn3 A G 11: 94,494,932 probably null Het
Fam151a A T 4: 106,734,004 I15F possibly damaging Het
Gm11115 T A 5: 88,154,050 probably null Het
Gm13103 A G 4: 143,852,814 D323G probably damaging Het
Golga3 T A 5: 110,204,895 I884N probably damaging Het
Gria2 A T 3: 80,692,469 F703I probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gtpbp2 A T 17: 46,164,111 probably null Het
Herc2 T C 7: 56,157,330 S2419P probably damaging Het
Ikbkap T C 4: 56,798,812 probably null Het
Inpp5d T C 1: 87,676,250 probably benign Het
Kdm2b C A 5: 122,961,469 V136F probably damaging Het
Klra2 T A 6: 131,221,876 D234V probably benign Het
Lct A T 1: 128,300,478 S1093T probably benign Het
March9 A G 10: 127,056,689 L310P probably benign Het
Morc1 G T 16: 48,587,124 E668* probably null Het
Mum1 A G 10: 80,232,279 T86A probably benign Het
Nbas A T 12: 13,405,425 L1213F probably damaging Het
Neto1 A G 18: 86,498,748 T397A possibly damaging Het
Oit3 A G 10: 59,429,640 C268R probably damaging Het
Olfr476 A G 7: 107,967,462 T22A probably benign Het
Pcx T C 19: 4,604,495 F312L probably benign Het
Pkhd1l1 G A 15: 44,498,089 probably null Het
Polr1a C A 6: 71,929,443 D414E possibly damaging Het
Prkch T C 12: 73,702,775 Y381H probably damaging Het
Ptger3 T A 3: 157,567,502 V162E probably damaging Het
Ptgr2 T G 12: 84,313,952 M332R probably damaging Het
Ptprq G T 10: 107,542,653 S2009* probably null Het
Rangrf C T 11: 68,973,688 G11R probably damaging Het
Rbl2 A T 8: 91,096,839 Q465L probably benign Het
Rhbdd1 A T 1: 82,340,659 M88L probably benign Het
Setd2 G A 9: 110,532,717 M13I probably benign Het
Sirpb1a T C 3: 15,379,020 Y384C probably damaging Het
Slc13a1 C T 6: 24,097,612 G439S probably damaging Het
Slc41a1 T A 1: 131,841,149 I239N probably damaging Het
Slit2 T A 5: 48,304,167 C1502S probably damaging Het
Slit3 G A 11: 35,661,292 E888K probably benign Het
Srrm3 G T 5: 135,835,234 R62L probably damaging Het
Synm A G 7: 67,735,583 V777A possibly damaging Het
Trmt13 T A 3: 116,592,215 N31I probably damaging Het
Trpm8 G A 1: 88,361,998 E893K probably damaging Het
Uqcc1 A G 2: 155,851,423 F197S probably damaging Het
Vmn1r67 T A 7: 10,447,671 N287K probably benign Het
Vmn2r44 A T 7: 8,378,099 M265K probably benign Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xdh C A 17: 73,900,551 C937F probably damaging Het
Zfp846 T A 9: 20,593,871 N342K probably benign Het
Other mutations in Pitx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Pitx2 APN 3 129214764 missense probably damaging 0.99
IGL02110:Pitx2 APN 3 129218817 missense probably damaging 0.99
R0014:Pitx2 UTSW 3 129218499 missense possibly damaging 0.70
R1083:Pitx2 UTSW 3 129218769 missense probably damaging 1.00
R1474:Pitx2 UTSW 3 129218839 missense probably damaging 1.00
R1789:Pitx2 UTSW 3 129218754 missense probably damaging 1.00
R1945:Pitx2 UTSW 3 129218536 missense probably damaging 1.00
R5305:Pitx2 UTSW 3 129215840 missense probably damaging 1.00
R5950:Pitx2 UTSW 3 129218520 missense probably damaging 1.00
R6114:Pitx2 UTSW 3 129204413 intron probably null
R6189:Pitx2 UTSW 3 129218469 missense probably damaging 1.00
R6192:Pitx2 UTSW 3 129215872 missense probably benign 0.09
R6226:Pitx2 UTSW 3 129215842 missense probably damaging 1.00
R6778:Pitx2 UTSW 3 129218743 missense probably damaging 1.00
R6885:Pitx2 UTSW 3 129218608 missense probably damaging 1.00
R7575:Pitx2 UTSW 3 129215726 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACTGCATGAAAGGCCCG -3'
(R):5'- TCCGTGACCCAAGAAACTG -3'

Sequencing Primer
(F):5'- TGCCCTTGGAGCACCGAG -3'
(R):5'- ACCAAGGTAGACTCGGCG -3'
Posted On2018-06-06