Incidental Mutation 'R6554:Cps1'
ID521816
Institutional Source Beutler Lab
Gene Symbol Cps1
Ensembl Gene ENSMUSG00000025991
Gene Namecarbamoyl-phosphate synthetase 1
SynonymsCPSase I, D1Ucla3, CPS, 4732433M03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6554 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location67123026-67231259 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 67174469 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 787 (R787*)
Ref Sequence ENSEMBL: ENSMUSP00000027144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027144]
Predicted Effect probably null
Transcript: ENSMUST00000027144
AA Change: R787*
SMART Domains Protein: ENSMUSP00000027144
Gene: ENSMUSG00000025991
AA Change: R787*

DomainStartEndE-ValueType
CPSase_sm_chain 44 184 2.5e-70 SMART
Pfam:GATase 221 397 1.5e-40 PFAM
low complexity region 426 436 N/A INTRINSIC
Pfam:ATP-grasp_4 543 724 6.8e-12 PFAM
Pfam:CPSase_L_D2 546 750 1.7e-85 PFAM
Pfam:ATP-grasp 554 722 4.9e-8 PFAM
Pfam:Dala_Dala_lig_C 561 718 1.5e-7 PFAM
CPSase_L_D3 839 962 1.18e-57 SMART
Pfam:ATP-grasp_4 1085 1264 1e-19 PFAM
Pfam:CPSase_L_D2 1088 1291 7.4e-32 PFAM
Pfam:Dala_Dala_lig_C 1095 1279 1.6e-6 PFAM
Pfam:ATP-grasp 1096 1263 2.8e-12 PFAM
MGS 1373 1465 1.53e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: This gene encodes a protein localized to the inner mitochondrial matrix. The encoded protein plays a role in the detoxification of ammonia by catalyzing the first step in the urea cycle in which carbomyl-phosphate is synthesized from ammonia and bicarbonate. Carbamoyl-phosphate is subsequently converted to urea that is excreted by the kidneys. Deficiency of the encoded enzyme leads to an accumulation of ammonia in the blood. High levels of ammonia are toxic to the central nervous system and result in neurological disorders. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygous mutation of this gene results in death by 36 hours after birth and hyperammonemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,641,287 R180C probably damaging Het
Ces1b C A 8: 93,064,991 V327L probably benign Het
D430042O09Rik C T 7: 125,850,742 R993C probably damaging Het
Dmrt2 C T 19: 25,677,948 P304S probably damaging Het
Dopey2 A G 16: 93,760,458 D429G probably benign Het
Dync1h1 T A 12: 110,649,848 M3111K probably benign Het
Dync2h1 A G 9: 7,037,699 V3393A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam184a T C 10: 53,640,967 D1007G possibly damaging Het
Flt3 A C 5: 147,375,735 L132W probably damaging Het
Gm14322 G A 2: 177,768,427 S60N possibly damaging Het
Gm34653 C A 2: 34,839,264 S358R probably benign Het
Gm35339 A G 15: 76,354,978 D85G possibly damaging Het
Kcnj16 T A 11: 111,025,305 Y264* probably null Het
Klkb1 T A 8: 45,273,554 I471F probably damaging Het
Lrfn4 T C 19: 4,613,886 T207A probably damaging Het
Mfsd4b5 T A 10: 39,986,432 T32S probably benign Het
Mtbp A G 15: 55,567,249 D234G probably damaging Het
Nfix T C 8: 84,727,650 T218A possibly damaging Het
Nsd3 A T 8: 25,662,875 E410D probably damaging Het
Olfr1284 C T 2: 111,379,159 S53F possibly damaging Het
Olfr259 A T 2: 87,107,626 S254T probably benign Het
Reln T C 5: 21,896,840 Y3364C probably damaging Het
Selplg G A 5: 113,820,149 P32L probably benign Het
Serpina1d A T 12: 103,764,803 H305Q probably benign Het
Skint8 G A 4: 111,927,216 C13Y probably benign Het
Smc4 G A 3: 69,029,515 V863I probably benign Het
Spdl1 T G 11: 34,822,570 N224T possibly damaging Het
Sprr1b T G 3: 92,437,113 Q152P possibly damaging Het
St6gal1 A G 16: 23,321,655 N192S probably benign Het
Tbc1d8 T C 1: 39,406,822 N96S probably damaging Het
Tbccd1 A T 16: 22,822,124 I501K probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Unk T C 11: 116,051,459 I293T probably damaging Het
Vmn2r61 A G 7: 42,276,715 E548G probably damaging Het
Wdr61 A T 9: 54,727,645 I88N probably damaging Het
Zeb2 A T 2: 44,997,512 V496E probably damaging Het
Other mutations in Cps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Cps1 APN 1 67152380 splice site probably benign
IGL00897:Cps1 APN 1 67215564 missense probably benign 0.08
IGL00928:Cps1 APN 1 67123234 missense probably benign
IGL01063:Cps1 APN 1 67195166 missense possibly damaging 0.91
IGL01081:Cps1 APN 1 67206824 missense probably damaging 1.00
IGL01361:Cps1 APN 1 67195145 missense probably benign 0.03
IGL01396:Cps1 APN 1 67157786 missense probably damaging 1.00
IGL01516:Cps1 APN 1 67230284 missense probably damaging 0.99
IGL01695:Cps1 APN 1 67197035 missense probably benign
IGL02022:Cps1 APN 1 67172872 splice site probably benign
IGL02032:Cps1 APN 1 67230315 missense probably benign 0.03
IGL02049:Cps1 APN 1 67143954 missense possibly damaging 0.68
IGL02197:Cps1 APN 1 67157764 missense probably benign
IGL02217:Cps1 APN 1 67174382 missense probably benign 0.06
IGL02555:Cps1 APN 1 67214021 missense probably benign 0.06
IGL02570:Cps1 APN 1 67148703 splice site probably benign
IGL02633:Cps1 APN 1 67123237 missense probably benign
IGL02711:Cps1 APN 1 67212517 splice site probably benign
IGL02737:Cps1 APN 1 67148774 missense probably benign 0.35
IGL03030:Cps1 APN 1 67142921 missense probably damaging 1.00
IGL03255:Cps1 APN 1 67145801 nonsense probably null
Madman UTSW 1 67160871 missense probably damaging 0.96
maniac UTSW 1 67157878 critical splice donor site probably null
R0109:Cps1 UTSW 1 67229418 missense possibly damaging 0.82
R0109:Cps1 UTSW 1 67229418 missense possibly damaging 0.82
R0140:Cps1 UTSW 1 67180116 missense probably benign
R0318:Cps1 UTSW 1 67177014 missense probably damaging 0.99
R0486:Cps1 UTSW 1 67165392 missense probably damaging 1.00
R0488:Cps1 UTSW 1 67148808 splice site probably benign
R0492:Cps1 UTSW 1 67157836 missense probably damaging 1.00
R0521:Cps1 UTSW 1 67215564 missense probably benign 0.02
R0534:Cps1 UTSW 1 67143900 missense probably benign 0.06
R0565:Cps1 UTSW 1 67166449 missense possibly damaging 0.57
R0609:Cps1 UTSW 1 67172802 missense probably damaging 1.00
R0612:Cps1 UTSW 1 67139770 missense probably benign 0.01
R1185:Cps1 UTSW 1 67195199 missense probably benign 0.00
R1185:Cps1 UTSW 1 67195199 missense probably benign 0.00
R1185:Cps1 UTSW 1 67195199 missense probably benign 0.00
R1220:Cps1 UTSW 1 67204703 critical splice donor site probably null
R1321:Cps1 UTSW 1 67143019 splice site probably benign
R1343:Cps1 UTSW 1 67209609 missense probably damaging 1.00
R1373:Cps1 UTSW 1 67229424 missense possibly damaging 0.89
R1374:Cps1 UTSW 1 67230281 missense probably damaging 0.97
R1481:Cps1 UTSW 1 67143882 missense probably damaging 0.99
R1711:Cps1 UTSW 1 67168374 splice site probably null
R1712:Cps1 UTSW 1 67230281 missense probably damaging 0.97
R1774:Cps1 UTSW 1 67170882 missense possibly damaging 0.94
R1799:Cps1 UTSW 1 67209642 missense probably damaging 1.00
R1954:Cps1 UTSW 1 67195196 missense possibly damaging 0.71
R2074:Cps1 UTSW 1 67204638 missense probably benign 0.21
R2078:Cps1 UTSW 1 67157806 missense probably damaging 1.00
R2078:Cps1 UTSW 1 67195265 missense possibly damaging 0.74
R2111:Cps1 UTSW 1 67176980 missense probably benign 0.01
R2112:Cps1 UTSW 1 67176980 missense probably benign 0.01
R2146:Cps1 UTSW 1 67152379 splice site probably benign
R2355:Cps1 UTSW 1 67156224 missense probably damaging 1.00
R2375:Cps1 UTSW 1 67217860 missense probably benign 0.00
R2860:Cps1 UTSW 1 67166375 missense probably benign 0.44
R2861:Cps1 UTSW 1 67166375 missense probably benign 0.44
R2979:Cps1 UTSW 1 67204704 critical splice donor site probably null
R3427:Cps1 UTSW 1 67174494 missense probably damaging 1.00
R3833:Cps1 UTSW 1 67139787 missense probably damaging 1.00
R3857:Cps1 UTSW 1 67168278 missense probably damaging 1.00
R3858:Cps1 UTSW 1 67168278 missense probably damaging 1.00
R3859:Cps1 UTSW 1 67168278 missense probably damaging 1.00
R3886:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R3887:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R3888:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R3889:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R4386:Cps1 UTSW 1 67170995 critical splice donor site probably null
R4497:Cps1 UTSW 1 67205199 missense probably null 1.00
R4671:Cps1 UTSW 1 67196560 missense probably damaging 1.00
R4774:Cps1 UTSW 1 67220512 missense probably damaging 0.99
R4799:Cps1 UTSW 1 67142986 missense probably damaging 0.96
R4853:Cps1 UTSW 1 67156202 missense possibly damaging 0.51
R4884:Cps1 UTSW 1 67177024 missense probably benign 0.11
R4900:Cps1 UTSW 1 67160904 missense probably damaging 1.00
R4906:Cps1 UTSW 1 67139763 missense probably benign 0.10
R5091:Cps1 UTSW 1 67229520 critical splice donor site probably null
R5102:Cps1 UTSW 1 67206793 missense probably benign 0.00
R5215:Cps1 UTSW 1 67166380 missense possibly damaging 0.62
R5290:Cps1 UTSW 1 67172709 missense probably benign 0.21
R5732:Cps1 UTSW 1 67157764 missense probably benign 0.22
R5818:Cps1 UTSW 1 67166488 missense possibly damaging 0.96
R5878:Cps1 UTSW 1 67157878 critical splice donor site probably null
R6002:Cps1 UTSW 1 67172755 missense possibly damaging 0.94
R6034:Cps1 UTSW 1 67157713 intron probably null
R6034:Cps1 UTSW 1 67157713 intron probably null
R6199:Cps1 UTSW 1 67162615 frame shift probably null
R6310:Cps1 UTSW 1 67142981 missense probably benign 0.00
R6700:Cps1 UTSW 1 67229523 splice site probably null
R6731:Cps1 UTSW 1 67160871 missense probably damaging 0.96
R7052:Cps1 UTSW 1 67198410 missense probably damaging 1.00
R7278:Cps1 UTSW 1 67170921 missense probably damaging 1.00
R7313:Cps1 UTSW 1 67198358 missense probably damaging 0.99
R7323:Cps1 UTSW 1 67157869 missense probably benign 0.03
R7339:Cps1 UTSW 1 67197015 missense possibly damaging 0.64
R7485:Cps1 UTSW 1 67139857 missense probably damaging 1.00
R7505:Cps1 UTSW 1 67180081 missense probably benign
R7748:Cps1 UTSW 1 67139806 missense probably damaging 1.00
R7853:Cps1 UTSW 1 67174481 missense possibly damaging 0.92
R7936:Cps1 UTSW 1 67174481 missense possibly damaging 0.92
X0024:Cps1 UTSW 1 67123247 missense probably benign
Z1176:Cps1 UTSW 1 67123268 missense possibly damaging 0.54
Z1176:Cps1 UTSW 1 67148719 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCAAGTCTGGAGTTGTTTTCAGTAC -3'
(R):5'- ACGAAACTTCTAGCAGCCAG -3'

Sequencing Primer
(F):5'- AATGAAGCTAACTCTGCCTCCTG -3'
(R):5'- GAAAATCAGGCATCCTCGTATC -3'
Posted On2018-06-06