Mutagenetix > Incidental Mutation

Incidental Mutation 'R6554:Cps1'

521816

Institutional Source

Beutler Lab

Gene Symbol

Cps1

Ensembl Gene

ENSMUSG00000025991

Gene Name

carbamoyl-phosphate synthetase 1

Synonyms

CPSase I, D1Ucla3, CPS, 4732433M03Rik

MMRRC Submission

044679-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6554 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

67123026-67231259 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 67174469 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 787 (R787*)

Ref Sequence

ENSEMBL: ENSMUSP00000027144 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027144]

AlphaFold

Q8C196

Predicted Effect

probably null
Transcript: ENSMUST00000027144
AA Change: R787*

SMART Domains

Protein: ENSMUSP00000027144
Gene: ENSMUSG00000025991
AA Change: R787*

Domain	Start	End	E-Value	Type
CPSase_sm_chain	44	184	2.5e-70	SMART
Pfam:GATase	221	397	1.5e-40	PFAM
low complexity region	426	436	N/A	INTRINSIC
Pfam:ATP-grasp_4	543	724	6.8e-12	PFAM
Pfam:CPSase_L_D2	546	750	1.7e-85	PFAM
Pfam:ATP-grasp	554	722	4.9e-8	PFAM
Pfam:Dala_Dala_lig_C	561	718	1.5e-7	PFAM
CPSase_L_D3	839	962	1.18e-57	SMART
Pfam:ATP-grasp_4	1085	1264	1e-19	PFAM
Pfam:CPSase_L_D2	1088	1291	7.4e-32	PFAM
Pfam:Dala_Dala_lig_C	1095	1279	1.6e-6	PFAM
Pfam:ATP-grasp	1096	1263	2.8e-12	PFAM
MGS	1373	1465	1.53e-15	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: This gene encodes a protein localized to the inner mitochondrial matrix. The encoded protein plays a role in the detoxification of ammonia by catalyzing the first step in the urea cycle in which carbomyl-phosphate is synthesized from ammonia and bicarbonate. Carbamoyl-phosphate is subsequently converted to urea that is excreted by the kidneys. Deficiency of the encoded enzyme leads to an accumulation of ammonia in the blood. High levels of ammonia are toxic to the central nervous system and result in neurological disorders. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygous mutation of this gene results in death by 36 hours after birth and hyperammonemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	C	T	6: 121,641,287	R180C	probably damaging	Het
Ces1b	C	A	8: 93,064,991	V327L	probably benign	Het
D430042O09Rik	C	T	7: 125,850,742	R993C	probably damaging	Het
Dmrt2	C	T	19: 25,677,948	P304S	probably damaging	Het
Dopey2	A	G	16: 93,760,458	D429G	probably benign	Het
Dync1h1	T	A	12: 110,649,848	M3111K	probably benign	Het
Dync2h1	A	G	9: 7,037,699	V3393A	probably benign	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Fam184a	T	C	10: 53,640,967	D1007G	possibly damaging	Het
Flt3	A	C	5: 147,375,735	L132W	probably damaging	Het
Gm14322	G	A	2: 177,768,427	S60N	possibly damaging	Het
Gm34653	C	A	2: 34,839,264	S358R	probably benign	Het
Gm35339	A	G	15: 76,354,978	D85G	possibly damaging	Het
Kcnj16	T	A	11: 111,025,305	Y264*	probably null	Het
Klkb1	T	A	8: 45,273,554	I471F	probably damaging	Het
Lrfn4	T	C	19: 4,613,886	T207A	probably damaging	Het
Mfsd4b5	T	A	10: 39,986,432	T32S	probably benign	Het
Mtbp	A	G	15: 55,567,249	D234G	probably damaging	Het
Nfix	T	C	8: 84,727,650	T218A	possibly damaging	Het
Nsd3	A	T	8: 25,662,875	E410D	probably damaging	Het
Olfr1284	C	T	2: 111,379,159	S53F	possibly damaging	Het
Olfr259	A	T	2: 87,107,626	S254T	probably benign	Het
Reln	T	C	5: 21,896,840	Y3364C	probably damaging	Het
Selplg	G	A	5: 113,820,149	P32L	probably benign	Het
Serpina1d	A	T	12: 103,764,803	H305Q	probably benign	Het
Skint8	G	A	4: 111,927,216	C13Y	probably benign	Het
Smc4	G	A	3: 69,029,515	V863I	probably benign	Het
Spdl1	T	G	11: 34,822,570	N224T	possibly damaging	Het
Sprr1b	T	G	3: 92,437,113	Q152P	possibly damaging	Het
St6gal1	A	G	16: 23,321,655	N192S	probably benign	Het
Tbc1d8	T	C	1: 39,406,822	N96S	probably damaging	Het
Tbccd1	A	T	16: 22,822,124	I501K	probably damaging	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Unk	T	C	11: 116,051,459	I293T	probably damaging	Het
Vmn2r61	A	G	7: 42,276,715	E548G	probably damaging	Het
Wdr61	A	T	9: 54,727,645	I88N	probably damaging	Het
Zeb2	A	T	2: 44,997,512	V496E	probably damaging	Het

Other mutations in Cps1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00757:Cps1	APN	1	67152380	splice site	probably benign
IGL00897:Cps1	APN	1	67215564	missense	probably benign	0.08
IGL00928:Cps1	APN	1	67123234	missense	probably benign
IGL01063:Cps1	APN	1	67195166	missense	possibly damaging	0.91
IGL01081:Cps1	APN	1	67206824	missense	probably damaging	1.00
IGL01361:Cps1	APN	1	67195145	missense	probably benign	0.03
IGL01396:Cps1	APN	1	67157786	missense	probably damaging	1.00
IGL01516:Cps1	APN	1	67230284	missense	probably damaging	0.99
IGL01695:Cps1	APN	1	67197035	missense	probably benign
IGL02022:Cps1	APN	1	67172872	splice site	probably benign
IGL02032:Cps1	APN	1	67230315	missense	probably benign	0.03
IGL02049:Cps1	APN	1	67143954	missense	possibly damaging	0.68
IGL02197:Cps1	APN	1	67157764	missense	probably benign
IGL02217:Cps1	APN	1	67174382	missense	probably benign	0.06
IGL02555:Cps1	APN	1	67214021	missense	probably benign	0.06
IGL02570:Cps1	APN	1	67148703	splice site	probably benign
IGL02633:Cps1	APN	1	67123237	missense	probably benign
IGL02711:Cps1	APN	1	67212517	splice site	probably benign
IGL02737:Cps1	APN	1	67148774	missense	probably benign	0.35
IGL03030:Cps1	APN	1	67142921	missense	probably damaging	1.00
IGL03255:Cps1	APN	1	67145801	nonsense	probably null
Madman	UTSW	1	67160871	missense	probably damaging	0.96
maniac	UTSW	1	67157878	critical splice donor site	probably null
R0109:Cps1	UTSW	1	67229418	missense	possibly damaging	0.82
R0109:Cps1	UTSW	1	67229418	missense	possibly damaging	0.82
R0140:Cps1	UTSW	1	67180116	missense	probably benign
R0318:Cps1	UTSW	1	67177014	missense	probably damaging	0.99
R0486:Cps1	UTSW	1	67165392	missense	probably damaging	1.00
R0488:Cps1	UTSW	1	67148808	splice site	probably benign
R0492:Cps1	UTSW	1	67157836	missense	probably damaging	1.00
R0521:Cps1	UTSW	1	67215564	missense	probably benign	0.02
R0534:Cps1	UTSW	1	67143900	missense	probably benign	0.06
R0565:Cps1	UTSW	1	67166449	missense	possibly damaging	0.57
R0609:Cps1	UTSW	1	67172802	missense	probably damaging	1.00
R0612:Cps1	UTSW	1	67139770	missense	probably benign	0.01
R1185:Cps1	UTSW	1	67195199	missense	probably benign	0.00
R1185:Cps1	UTSW	1	67195199	missense	probably benign	0.00
R1185:Cps1	UTSW	1	67195199	missense	probably benign	0.00
R1220:Cps1	UTSW	1	67204703	critical splice donor site	probably null
R1321:Cps1	UTSW	1	67143019	splice site	probably benign
R1343:Cps1	UTSW	1	67209609	missense	probably damaging	1.00
R1373:Cps1	UTSW	1	67229424	missense	possibly damaging	0.89
R1374:Cps1	UTSW	1	67230281	missense	probably damaging	0.97
R1481:Cps1	UTSW	1	67143882	missense	probably damaging	0.99
R1711:Cps1	UTSW	1	67168374	splice site	probably null
R1712:Cps1	UTSW	1	67230281	missense	probably damaging	0.97
R1774:Cps1	UTSW	1	67170882	missense	possibly damaging	0.94
R1799:Cps1	UTSW	1	67209642	missense	probably damaging	1.00
R1954:Cps1	UTSW	1	67195196	missense	possibly damaging	0.71
R2074:Cps1	UTSW	1	67204638	missense	probably benign	0.21
R2078:Cps1	UTSW	1	67157806	missense	probably damaging	1.00
R2078:Cps1	UTSW	1	67195265	missense	possibly damaging	0.74
R2111:Cps1	UTSW	1	67176980	missense	probably benign	0.01
R2112:Cps1	UTSW	1	67176980	missense	probably benign	0.01
R2146:Cps1	UTSW	1	67152379	splice site	probably benign
R2355:Cps1	UTSW	1	67156224	missense	probably damaging	1.00
R2375:Cps1	UTSW	1	67217860	missense	probably benign	0.00
R2860:Cps1	UTSW	1	67166375	missense	probably benign	0.44
R2861:Cps1	UTSW	1	67166375	missense	probably benign	0.44
R2979:Cps1	UTSW	1	67204704	critical splice donor site	probably null
R3427:Cps1	UTSW	1	67174494	missense	probably damaging	1.00
R3833:Cps1	UTSW	1	67139787	missense	probably damaging	1.00
R3857:Cps1	UTSW	1	67168278	missense	probably damaging	1.00
R3858:Cps1	UTSW	1	67168278	missense	probably damaging	1.00
R3859:Cps1	UTSW	1	67168278	missense	probably damaging	1.00
R3886:Cps1	UTSW	1	67165500	missense	possibly damaging	0.83
R3887:Cps1	UTSW	1	67165500	missense	possibly damaging	0.83
R3888:Cps1	UTSW	1	67165500	missense	possibly damaging	0.83
R3889:Cps1	UTSW	1	67165500	missense	possibly damaging	0.83
R4386:Cps1	UTSW	1	67170995	critical splice donor site	probably null
R4497:Cps1	UTSW	1	67205199	missense	probably null	1.00
R4671:Cps1	UTSW	1	67196560	missense	probably damaging	1.00
R4774:Cps1	UTSW	1	67220512	missense	probably damaging	0.99
R4799:Cps1	UTSW	1	67142986	missense	probably damaging	0.96
R4853:Cps1	UTSW	1	67156202	missense	possibly damaging	0.51
R4884:Cps1	UTSW	1	67177024	missense	probably benign	0.11
R4900:Cps1	UTSW	1	67160904	missense	probably damaging	1.00
R4906:Cps1	UTSW	1	67139763	missense	probably benign	0.10
R5091:Cps1	UTSW	1	67229520	critical splice donor site	probably null
R5102:Cps1	UTSW	1	67206793	missense	probably benign	0.00
R5215:Cps1	UTSW	1	67166380	missense	possibly damaging	0.62
R5290:Cps1	UTSW	1	67172709	missense	probably benign	0.21
R5732:Cps1	UTSW	1	67157764	missense	probably benign	0.22
R5818:Cps1	UTSW	1	67166488	missense	possibly damaging	0.96
R5878:Cps1	UTSW	1	67157878	critical splice donor site	probably null
R6002:Cps1	UTSW	1	67172755	missense	possibly damaging	0.94
R6034:Cps1	UTSW	1	67157713	splice site	probably null
R6034:Cps1	UTSW	1	67157713	splice site	probably null
R6199:Cps1	UTSW	1	67162615	frame shift	probably null
R6310:Cps1	UTSW	1	67142981	missense	probably benign	0.00
R6700:Cps1	UTSW	1	67229523	splice site	probably null
R6731:Cps1	UTSW	1	67160871	missense	probably damaging	0.96
R7052:Cps1	UTSW	1	67198410	missense	probably damaging	1.00
R7278:Cps1	UTSW	1	67170921	missense	probably damaging	1.00
R7313:Cps1	UTSW	1	67198358	missense	probably damaging	0.99
R7323:Cps1	UTSW	1	67157869	missense	probably benign	0.03
R7339:Cps1	UTSW	1	67197015	missense	possibly damaging	0.64
R7485:Cps1	UTSW	1	67139857	missense	probably damaging	1.00
R7505:Cps1	UTSW	1	67180081	missense	probably benign
R7748:Cps1	UTSW	1	67139806	missense	probably damaging	1.00
R7853:Cps1	UTSW	1	67174481	missense	possibly damaging	0.92
R8097:Cps1	UTSW	1	67228270	missense	probably benign	0.08
R8357:Cps1	UTSW	1	67156854	missense	probably damaging	1.00
R8435:Cps1	UTSW	1	67212430	missense	probably benign	0.07
R8457:Cps1	UTSW	1	67156854	missense	probably damaging	1.00
R8680:Cps1	UTSW	1	67204613	missense	probably damaging	1.00
R8805:Cps1	UTSW	1	67176951	missense	probably damaging	1.00
R8811:Cps1	UTSW	1	67214087	missense	probably benign	0.03
R8819:Cps1	UTSW	1	67228280	missense	possibly damaging	0.56
R8820:Cps1	UTSW	1	67228280	missense	possibly damaging	0.56
R8854:Cps1	UTSW	1	67160889	missense	probably damaging	1.00
R9138:Cps1	UTSW	1	67215410	missense	probably damaging	1.00
R9185:Cps1	UTSW	1	67209672	missense	probably benign	0.08
R9273:Cps1	UTSW	1	67152286	missense	possibly damaging	0.69
R9286:Cps1	UTSW	1	67158871	missense	probably damaging	0.99
R9308:Cps1	UTSW	1	67160959	critical splice donor site	probably null
R9326:Cps1	UTSW	1	67209636	missense	probably damaging	1.00
R9449:Cps1	UTSW	1	67220512	missense	probably damaging	0.99
R9454:Cps1	UTSW	1	67180152	missense	probably damaging	0.97
R9518:Cps1	UTSW	1	67220503	missense	probably damaging	1.00
R9564:Cps1	UTSW	1	67158889	missense	probably benign	0.26
R9585:Cps1	UTSW	1	67156182	missense	probably damaging	0.99
R9618:Cps1	UTSW	1	67157816	missense	possibly damaging	0.87
R9641:Cps1	UTSW	1	67195183	missense	probably benign	0.03
R9650:Cps1	UTSW	1	67215477	missense
R9668:Cps1	UTSW	1	67174490	missense	probably benign	0.24
R9726:Cps1	UTSW	1	67156236	missense	probably benign	0.39
X0024:Cps1	UTSW	1	67123247	missense	probably benign
Z1176:Cps1	UTSW	1	67123268	missense	possibly damaging	0.54
Z1176:Cps1	UTSW	1	67148719	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TCAAGTCTGGAGTTGTTTTCAGTAC -3'
(R):5'- ACGAAACTTCTAGCAGCCAG -3'

Sequencing Primer
(F):5'- AATGAAGCTAACTCTGCCTCCTG -3'
(R):5'- GAAAATCAGGCATCCTCGTATC -3'

Posted On

2018-06-06