Incidental Mutation 'R6526:Chek2'
ID521829
Institutional Source Beutler Lab
Gene Symbol Chek2
Ensembl Gene ENSMUSG00000029521
Gene Namecheckpoint kinase 2
SynonymsRad53, CHK2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6526 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location110839979-110874145 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110848690 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 173 (F173L)
Ref Sequence ENSEMBL: ENSMUSP00000066679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066160] [ENSMUST00000199937]
Predicted Effect probably damaging
Transcript: ENSMUST00000066160
AA Change: F173L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066679
Gene: ENSMUSG00000029521
AA Change: F173L

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
low complexity region 41 72 N/A INTRINSIC
FHA 116 179 5.14e-3 SMART
S_TKc 224 490 7.35e-104 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000199937
AA Change: F173L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143558
Gene: ENSMUSG00000029521
AA Change: F173L

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
low complexity region 41 72 N/A INTRINSIC
FHA 116 179 2.6e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200630
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In response to DNA damage and replication blocks, cell cycle progression is halted through the control of critical cell cycle regulators. The protein encoded by this gene is a cell cycle checkpoint regulator and putative tumor suppressor. It contains a forkhead-associated protein interaction domain essential for activation in response to DNA damage and is rapidly phosphorylated in response to replication blocks and DNA damage. When activated, the encoded protein is known to inhibit CDC25C phosphatase, preventing entry into mitosis, and has been shown to stabilize the tumor suppressor protein p53, leading to cell cycle arrest in G1. In addition, this protein interacts with and phosphorylates BRCA1, allowing BRCA1 to restore survival after DNA damage. Mutations in this gene have been linked with Li-Fraumeni syndrome, a highly penetrant familial cancer phenotype usually associated with inherited mutations in TP53. Also, mutations in this gene are thought to confer a predisposition to sarcomas, breast cancer, and brain tumors. This nuclear protein is a member of the CDS1 subfamily of serine/threonine protein kinases. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous mutation of this gene does not increase tumor incidence. Cells from the thymus, central nervous system (CNS), hair follicles, and skin are resistant to ionizing radiation- and gamma irradiation-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,284,172 probably null Het
Abcc3 C T 11: 94,359,372 G975D probably benign Het
Abhd13 G A 8: 9,987,777 G125S probably damaging Het
Ache T A 5: 137,290,644 L204Q probably damaging Het
Acnat2 A G 4: 49,383,497 S19P probably benign Het
Adprh A G 16: 38,447,276 Y216H probably benign Het
Anapc1 T A 2: 128,672,135 K429* probably null Het
Anxa13 T C 15: 58,344,957 noncoding transcript Het
Aprt A C 8: 122,576,816 L6W probably damaging Het
Arhgef15 T C 11: 68,949,994 T569A probably damaging Het
Atp11a T C 8: 12,864,999 L1139P probably benign Het
Atp2b4 A G 1: 133,711,729 S1136P probably damaging Het
B9d1 T A 11: 61,509,097 Y90* probably null Het
Btla G A 16: 45,239,094 A54T probably damaging Het
Cd63 T C 10: 128,911,489 V35A probably benign Het
Cntnap3 T A 13: 64,781,888 N499I possibly damaging Het
Cog4 T C 8: 110,881,786 L738P probably damaging Het
Cops6 T C 5: 138,163,900 probably null Het
Cpeb1 T A 7: 81,361,669 I175F probably benign Het
Cyp3a16 C T 5: 145,455,895 D174N probably benign Het
Dnah6 T G 6: 73,074,704 I2984L probably benign Het
Dock10 A T 1: 80,586,351 I540N probably damaging Het
Elf5 A G 2: 103,439,233 Y53C probably damaging Het
Elmod2 T C 8: 83,319,457 T164A probably damaging Het
Epn3 A G 11: 94,494,932 probably null Het
Fam151a A T 4: 106,734,004 I15F possibly damaging Het
Gm11115 T A 5: 88,154,050 probably null Het
Gm13103 A G 4: 143,852,814 D323G probably damaging Het
Golga3 T A 5: 110,204,895 I884N probably damaging Het
Gria2 A T 3: 80,692,469 F703I probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gtpbp2 A T 17: 46,164,111 probably null Het
Herc2 T C 7: 56,157,330 S2419P probably damaging Het
Ikbkap T C 4: 56,798,812 probably null Het
Inpp5d T C 1: 87,676,250 probably benign Het
Kdm2b C A 5: 122,961,469 V136F probably damaging Het
Klra2 T A 6: 131,221,876 D234V probably benign Het
Lct A T 1: 128,300,478 S1093T probably benign Het
March9 A G 10: 127,056,689 L310P probably benign Het
Morc1 G T 16: 48,587,124 E668* probably null Het
Mum1 A G 10: 80,232,279 T86A probably benign Het
Nbas A T 12: 13,405,425 L1213F probably damaging Het
Neto1 A G 18: 86,498,748 T397A possibly damaging Het
Oit3 A G 10: 59,429,640 C268R probably damaging Het
Olfr476 A G 7: 107,967,462 T22A probably benign Het
Pcx T C 19: 4,604,495 F312L probably benign Het
Pitx2 T C 3: 129,214,783 probably null Het
Pkhd1l1 G A 15: 44,498,089 probably null Het
Polr1a C A 6: 71,929,443 D414E possibly damaging Het
Prkch T C 12: 73,702,775 Y381H probably damaging Het
Ptger3 T A 3: 157,567,502 V162E probably damaging Het
Ptgr2 T G 12: 84,313,952 M332R probably damaging Het
Ptprq G T 10: 107,542,653 S2009* probably null Het
Rangrf C T 11: 68,973,688 G11R probably damaging Het
Rbl2 A T 8: 91,096,839 Q465L probably benign Het
Rhbdd1 A T 1: 82,340,659 M88L probably benign Het
Setd2 G A 9: 110,532,717 M13I probably benign Het
Sirpb1a T C 3: 15,379,020 Y384C probably damaging Het
Slc13a1 C T 6: 24,097,612 G439S probably damaging Het
Slc41a1 T A 1: 131,841,149 I239N probably damaging Het
Slit2 T A 5: 48,304,167 C1502S probably damaging Het
Slit3 G A 11: 35,661,292 E888K probably benign Het
Srrm3 G T 5: 135,835,234 R62L probably damaging Het
Synm A G 7: 67,735,583 V777A possibly damaging Het
Trmt13 T A 3: 116,592,215 N31I probably damaging Het
Trpm8 G A 1: 88,361,998 E893K probably damaging Het
Uqcc1 A G 2: 155,851,423 F197S probably damaging Het
Vmn1r67 T A 7: 10,447,671 N287K probably benign Het
Vmn2r44 A T 7: 8,378,099 M265K probably benign Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xdh C A 17: 73,900,551 C937F probably damaging Het
Zfp846 T A 9: 20,593,871 N342K probably benign Het
Other mutations in Chek2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Chek2 APN 5 110848670 missense probably damaging 1.00
IGL01830:Chek2 APN 5 110873508 missense probably benign
IGL01943:Chek2 APN 5 110841227 unclassified probably benign
IGL02319:Chek2 APN 5 110867011 missense possibly damaging 0.88
IGL03147:Chek2 UTSW 5 110848670 missense probably damaging 1.00
PIT4520001:Chek2 UTSW 5 110863329 missense probably damaging 1.00
R1484:Chek2 UTSW 5 110848687 missense probably damaging 1.00
R1486:Chek2 UTSW 5 110841227 unclassified probably benign
R1732:Chek2 UTSW 5 110872102 missense probably benign 0.26
R2041:Chek2 UTSW 5 110848664 missense probably damaging 1.00
R2071:Chek2 UTSW 5 110841246 unclassified probably benign
R2873:Chek2 UTSW 5 110863336 nonsense probably null
R2935:Chek2 UTSW 5 110868020 missense probably damaging 1.00
R3899:Chek2 UTSW 5 110865613 splice site probably benign
R4662:Chek2 UTSW 5 110867042 missense probably damaging 1.00
R4748:Chek2 UTSW 5 110855839 splice site probably null
R5358:Chek2 UTSW 5 110841282 unclassified probably benign
R5582:Chek2 UTSW 5 110868035 missense probably damaging 0.96
R5594:Chek2 UTSW 5 110855834 critical splice donor site probably null
R6972:Chek2 UTSW 5 110855839 splice site probably null
R7232:Chek2 UTSW 5 110860915 missense probably damaging 1.00
R7338:Chek2 UTSW 5 110873514 missense probably benign
R7395:Chek2 UTSW 5 110872108 critical splice donor site probably null
R7714:Chek2 UTSW 5 110841453 missense probably benign 0.10
R7743:Chek2 UTSW 5 110840050 critical splice donor site probably null
R8290:Chek2 UTSW 5 110860900 missense possibly damaging 0.70
R8297:Chek2 UTSW 5 110848436 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGGTAGGTAACGGTTGC -3'
(R):5'- CTCTTGGATGCTACTGAACACTG -3'

Sequencing Primer
(F):5'- AGGTAACGGTTGCTTCTCTC -3'
(R):5'- GGATGCTACTGAACACTGACTTAC -3'
Posted On2018-06-06