Incidental Mutation 'R6526:Kdm2b'
ID521831
Institutional Source Beutler Lab
Gene Symbol Kdm2b
Ensembl Gene ENSMUSG00000029475
Gene Namelysine (K)-specific demethylase 2B
SynonymsJhdm1b, Fbxl10, Cxxc2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6526 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location122870665-122989823 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 122961469 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 136 (V136F)
Ref Sequence ENSEMBL: ENSMUSP00000118488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046073] [ENSMUST00000086200] [ENSMUST00000118027] [ENSMUST00000121739] [ENSMUST00000127403] [ENSMUST00000156474]
Predicted Effect probably damaging
Transcript: ENSMUST00000046073
AA Change: V142F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038229
Gene: ENSMUSG00000029475
AA Change: V142F

DomainStartEndE-ValueType
Blast:JmjC 23 101 4e-41 BLAST
JmjC 147 315 3.61e-41 SMART
low complexity region 380 401 N/A INTRINSIC
low complexity region 406 424 N/A INTRINSIC
PDB:2YU2|A 472 546 1e-17 PDB
Pfam:zf-CXXC 578 624 3e-17 PFAM
PHD 634 696 8.58e-4 SMART
low complexity region 792 823 N/A INTRINSIC
low complexity region 903 913 N/A INTRINSIC
low complexity region 990 1006 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
FBOX 1038 1078 1.69e-2 SMART
LRR 1121 1143 1.31e2 SMART
LRR 1145 1170 2.9e2 SMART
LRR 1185 1209 2.04e2 SMART
LRR 1210 1235 1.1e1 SMART
LRR 1265 1290 3.91e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000086200
AA Change: V136F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083376
Gene: ENSMUSG00000029475
AA Change: V136F

DomainStartEndE-ValueType
Blast:JmjC 17 95 4e-41 BLAST
JmjC 141 309 3.61e-41 SMART
low complexity region 374 395 N/A INTRINSIC
low complexity region 400 418 N/A INTRINSIC
PDB:2YU2|A 466 540 1e-17 PDB
Pfam:zf-CXXC 572 618 2.1e-17 PFAM
PHD 628 690 8.58e-4 SMART
low complexity region 786 817 N/A INTRINSIC
low complexity region 897 907 N/A INTRINSIC
low complexity region 984 1000 N/A INTRINSIC
low complexity region 1012 1026 N/A INTRINSIC
FBOX 1032 1072 1.69e-2 SMART
LRR 1115 1137 1.31e2 SMART
LRR 1139 1164 2.9e2 SMART
LRR 1179 1203 2.04e2 SMART
LRR 1204 1229 1.1e1 SMART
LRR 1259 1284 3.91e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118027
AA Change: V142F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114052
Gene: ENSMUSG00000029475
AA Change: V142F

DomainStartEndE-ValueType
Blast:JmjC 23 101 4e-41 BLAST
JmjC 147 315 3.61e-41 SMART
low complexity region 380 401 N/A INTRINSIC
low complexity region 406 424 N/A INTRINSIC
PDB:2YU2|A 472 546 9e-18 PDB
Pfam:zf-CXXC 578 624 2.1e-17 PFAM
PHD 634 696 8.58e-4 SMART
low complexity region 865 875 N/A INTRINSIC
low complexity region 952 968 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
FBOX 1000 1040 1.69e-2 SMART
LRR 1083 1105 1.31e2 SMART
LRR 1107 1132 2.9e2 SMART
LRR 1147 1171 2.04e2 SMART
LRR 1172 1197 1.1e1 SMART
LRR 1227 1252 3.91e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121739
AA Change: V87F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114049
Gene: ENSMUSG00000029475
AA Change: V87F

DomainStartEndE-ValueType
Blast:JmjC 1 46 2e-19 BLAST
JmjC 92 260 3.61e-41 SMART
low complexity region 325 346 N/A INTRINSIC
low complexity region 351 369 N/A INTRINSIC
PDB:2YU2|A 417 491 1e-17 PDB
Pfam:zf-CXXC 523 569 5.4e-17 PFAM
PHD 579 641 8.58e-4 SMART
low complexity region 737 768 N/A INTRINSIC
low complexity region 848 858 N/A INTRINSIC
low complexity region 935 951 N/A INTRINSIC
low complexity region 963 977 N/A INTRINSIC
FBOX 983 1023 1.69e-2 SMART
LRR 1066 1088 1.31e2 SMART
LRR 1090 1115 2.9e2 SMART
LRR 1130 1154 2.04e2 SMART
LRR 1155 1180 1.1e1 SMART
LRR 1210 1235 3.91e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123479
Predicted Effect probably benign
Transcript: ENSMUST00000127403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150543
Predicted Effect probably damaging
Transcript: ENSMUST00000156474
AA Change: V136F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118488
Gene: ENSMUSG00000029475
AA Change: V136F

DomainStartEndE-ValueType
Blast:JmjC 17 95 3e-42 BLAST
JmjC 141 309 3.61e-41 SMART
low complexity region 374 395 N/A INTRINSIC
low complexity region 400 418 N/A INTRINSIC
PDB:2YU2|A 466 512 1e-8 PDB
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: The protein encoded by this gene is a H3K36-specific histone demethylase, which contains an N-terminal jumonji C domain, a CxxC zinc finger domain, a plant homeodomain finger, an F-box, and eight leucine-rich repeats. Amongst its demonstrated functions, this protein plays roles in the suppression of premature cellular senescence, leukemia maintenance and development, maintenance of mouse embryonic stem cell pluripotency, and induced pluripotent stem cell generation. Mice homozygous for a targeted deletion of the zinc finger domain display embryonic lethality with development ceasing at approximately 7 to 8 days post coitum, demonstrating an essential role in early development. A pseudogene of this gene is found on chromosome 4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a targeted allele that does not express the long form protein exhibit exencephaly, fetal and postnatal lethality, coloboma, curly tail, oligozoospermia, increased apoptosis, and increased neuronal precursor proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,284,172 probably null Het
Abcc3 C T 11: 94,359,372 G975D probably benign Het
Abhd13 G A 8: 9,987,777 G125S probably damaging Het
Ache T A 5: 137,290,644 L204Q probably damaging Het
Acnat2 A G 4: 49,383,497 S19P probably benign Het
Adprh A G 16: 38,447,276 Y216H probably benign Het
Anapc1 T A 2: 128,672,135 K429* probably null Het
Anxa13 T C 15: 58,344,957 noncoding transcript Het
Aprt A C 8: 122,576,816 L6W probably damaging Het
Arhgef15 T C 11: 68,949,994 T569A probably damaging Het
Atp11a T C 8: 12,864,999 L1139P probably benign Het
Atp2b4 A G 1: 133,711,729 S1136P probably damaging Het
B9d1 T A 11: 61,509,097 Y90* probably null Het
Btla G A 16: 45,239,094 A54T probably damaging Het
Cd63 T C 10: 128,911,489 V35A probably benign Het
Chek2 T C 5: 110,848,690 F173L probably damaging Het
Cntnap3 T A 13: 64,781,888 N499I possibly damaging Het
Cog4 T C 8: 110,881,786 L738P probably damaging Het
Cops6 T C 5: 138,163,900 probably null Het
Cpeb1 T A 7: 81,361,669 I175F probably benign Het
Cyp3a16 C T 5: 145,455,895 D174N probably benign Het
Dnah6 T G 6: 73,074,704 I2984L probably benign Het
Dock10 A T 1: 80,586,351 I540N probably damaging Het
Elf5 A G 2: 103,439,233 Y53C probably damaging Het
Elmod2 T C 8: 83,319,457 T164A probably damaging Het
Epn3 A G 11: 94,494,932 probably null Het
Fam151a A T 4: 106,734,004 I15F possibly damaging Het
Gm11115 T A 5: 88,154,050 probably null Het
Gm13103 A G 4: 143,852,814 D323G probably damaging Het
Golga3 T A 5: 110,204,895 I884N probably damaging Het
Gria2 A T 3: 80,692,469 F703I probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gtpbp2 A T 17: 46,164,111 probably null Het
Herc2 T C 7: 56,157,330 S2419P probably damaging Het
Ikbkap T C 4: 56,798,812 probably null Het
Inpp5d T C 1: 87,676,250 probably benign Het
Klra2 T A 6: 131,221,876 D234V probably benign Het
Lct A T 1: 128,300,478 S1093T probably benign Het
March9 A G 10: 127,056,689 L310P probably benign Het
Morc1 G T 16: 48,587,124 E668* probably null Het
Mum1 A G 10: 80,232,279 T86A probably benign Het
Nbas A T 12: 13,405,425 L1213F probably damaging Het
Neto1 A G 18: 86,498,748 T397A possibly damaging Het
Oit3 A G 10: 59,429,640 C268R probably damaging Het
Olfr476 A G 7: 107,967,462 T22A probably benign Het
Pcx T C 19: 4,604,495 F312L probably benign Het
Pitx2 T C 3: 129,214,783 probably null Het
Pkhd1l1 G A 15: 44,498,089 probably null Het
Polr1a C A 6: 71,929,443 D414E possibly damaging Het
Prkch T C 12: 73,702,775 Y381H probably damaging Het
Ptger3 T A 3: 157,567,502 V162E probably damaging Het
Ptgr2 T G 12: 84,313,952 M332R probably damaging Het
Ptprq G T 10: 107,542,653 S2009* probably null Het
Rangrf C T 11: 68,973,688 G11R probably damaging Het
Rbl2 A T 8: 91,096,839 Q465L probably benign Het
Rhbdd1 A T 1: 82,340,659 M88L probably benign Het
Setd2 G A 9: 110,532,717 M13I probably benign Het
Sirpb1a T C 3: 15,379,020 Y384C probably damaging Het
Slc13a1 C T 6: 24,097,612 G439S probably damaging Het
Slc41a1 T A 1: 131,841,149 I239N probably damaging Het
Slit2 T A 5: 48,304,167 C1502S probably damaging Het
Slit3 G A 11: 35,661,292 E888K probably benign Het
Srrm3 G T 5: 135,835,234 R62L probably damaging Het
Synm A G 7: 67,735,583 V777A possibly damaging Het
Trmt13 T A 3: 116,592,215 N31I probably damaging Het
Trpm8 G A 1: 88,361,998 E893K probably damaging Het
Uqcc1 A G 2: 155,851,423 F197S probably damaging Het
Vmn1r67 T A 7: 10,447,671 N287K probably benign Het
Vmn2r44 A T 7: 8,378,099 M265K probably benign Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xdh C A 17: 73,900,551 C937F probably damaging Het
Zfp846 T A 9: 20,593,871 N342K probably benign Het
Other mutations in Kdm2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Kdm2b APN 5 122961567 missense probably damaging 1.00
IGL02061:Kdm2b APN 5 122883341 missense probably damaging 1.00
IGL02142:Kdm2b APN 5 122947835 missense probably damaging 0.99
IGL02143:Kdm2b APN 5 122947835 missense probably damaging 0.99
IGL02147:Kdm2b APN 5 122947835 missense probably damaging 0.99
IGL02294:Kdm2b APN 5 122961474 missense probably damaging 1.00
IGL02309:Kdm2b APN 5 122947820 missense probably damaging 0.99
IGL03039:Kdm2b APN 5 122881671 missense probably benign 0.06
IGL03134:Kdm2b UTSW 5 122932674 missense probably damaging 1.00
PIT4520001:Kdm2b UTSW 5 122941047 missense probably damaging 1.00
R0008:Kdm2b UTSW 5 122881743 missense probably benign 0.08
R0592:Kdm2b UTSW 5 122961134 splice site probably benign
R0894:Kdm2b UTSW 5 122984460 critical splice donor site probably null
R1078:Kdm2b UTSW 5 122961541 missense possibly damaging 0.83
R1387:Kdm2b UTSW 5 122880268 missense probably damaging 1.00
R1441:Kdm2b UTSW 5 122932880 missense probably benign 0.25
R1550:Kdm2b UTSW 5 122881057 missense probably damaging 1.00
R1795:Kdm2b UTSW 5 122984460 critical splice donor site probably null
R2060:Kdm2b UTSW 5 122883365 missense probably damaging 1.00
R2161:Kdm2b UTSW 5 122880699 missense probably damaging 1.00
R2259:Kdm2b UTSW 5 122882416 missense probably damaging 1.00
R3843:Kdm2b UTSW 5 122934793 missense probably damaging 0.98
R3844:Kdm2b UTSW 5 122934793 missense probably damaging 0.98
R3859:Kdm2b UTSW 5 122880227 missense probably damaging 1.00
R4506:Kdm2b UTSW 5 122888625 missense possibly damaging 0.58
R4680:Kdm2b UTSW 5 122934786 missense probably damaging 0.99
R4786:Kdm2b UTSW 5 122880854 critical splice acceptor site probably null
R4894:Kdm2b UTSW 5 122940967 nonsense probably null
R5265:Kdm2b UTSW 5 122878588 missense probably damaging 1.00
R5522:Kdm2b UTSW 5 122949162 missense probably damaging 1.00
R5746:Kdm2b UTSW 5 122879364 missense probably damaging 1.00
R5813:Kdm2b UTSW 5 122871868 missense probably benign 0.37
R5920:Kdm2b UTSW 5 122880296 missense probably damaging 1.00
R5961:Kdm2b UTSW 5 122932661 missense probably benign 0.37
R6029:Kdm2b UTSW 5 122879587 missense probably damaging 1.00
R6280:Kdm2b UTSW 5 122878624 missense probably damaging 1.00
R6303:Kdm2b UTSW 5 122881744 missense probably benign 0.34
R6304:Kdm2b UTSW 5 122881744 missense probably benign 0.34
R6383:Kdm2b UTSW 5 122934778 missense probably damaging 1.00
R6432:Kdm2b UTSW 5 122880191 missense probably damaging 1.00
R6513:Kdm2b UTSW 5 122880239 missense probably damaging 0.99
R7213:Kdm2b UTSW 5 122921469 missense probably damaging 0.99
R7226:Kdm2b UTSW 5 122921449 missense possibly damaging 0.60
R7292:Kdm2b UTSW 5 122880791 missense probably damaging 0.98
R7893:Kdm2b UTSW 5 122947739 missense probably benign 0.12
R7976:Kdm2b UTSW 5 122947739 missense probably benign 0.12
R8021:Kdm2b UTSW 5 122932919 missense probably damaging 0.99
Z1177:Kdm2b UTSW 5 122880797 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCATCAGATCCAACTCTGCC -3'
(R):5'- AGCTCTGTAGGAGAAGCAGTTG -3'

Sequencing Primer
(F):5'- TAAGGGATCAGTCTCGGCCAC -3'
(R):5'- CTCCCTCGTGGCGTCTG -3'
Posted On2018-06-06