Incidental Mutation 'R6526:Polr1a'
ID521841
Institutional Source Beutler Lab
Gene Symbol Polr1a
Ensembl Gene ENSMUSG00000049553
Gene Namepolymerase (RNA) I polypeptide A
SynonymsRPA194, 3010014K16Rik, 194kDa, mRPA1, Rpo1-4
MMRRC Submission
Accession Numbers

Genbank: NM_009088; MGI: 1096397

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6526 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location71909053-71984935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 71929443 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 414 (D414E)
Ref Sequence ENSEMBL: ENSMUSP00000060858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055296] [ENSMUST00000206556]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055296
AA Change: D414E

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000060858
Gene: ENSMUSG00000049553
AA Change: D414E

DomainStartEndE-ValueType
RPOLA_N 302 649 8.97e-137 SMART
Pfam:RNA_pol_Rpb1_4 846 958 1.3e-26 PFAM
Pfam:RNA_pol_Rpb1_5 965 1669 7e-103 PFAM
low complexity region 1698 1708 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205333
Predicted Effect probably benign
Transcript: ENSMUST00000206556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206753
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206823
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the largest subunit of the RNA polymerase I complex. The encoded protein represents the catalytic subunit of the complex, which transcribes DNA into ribosomal RNA precursors. Defects in this gene are a cause of the Cincinnati type of acrofacial dysostosis. [provided by RefSeq, May 2016]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,284,172 probably null Het
Abcc3 C T 11: 94,359,372 G975D probably benign Het
Abhd13 G A 8: 9,987,777 G125S probably damaging Het
Ache T A 5: 137,290,644 L204Q probably damaging Het
Acnat2 A G 4: 49,383,497 S19P probably benign Het
Adprh A G 16: 38,447,276 Y216H probably benign Het
Anapc1 T A 2: 128,672,135 K429* probably null Het
Anxa13 T C 15: 58,344,957 noncoding transcript Het
Aprt A C 8: 122,576,816 L6W probably damaging Het
Arhgef15 T C 11: 68,949,994 T569A probably damaging Het
Atp11a T C 8: 12,864,999 L1139P probably benign Het
Atp2b4 A G 1: 133,711,729 S1136P probably damaging Het
B9d1 T A 11: 61,509,097 Y90* probably null Het
Btla G A 16: 45,239,094 A54T probably damaging Het
Cd63 T C 10: 128,911,489 V35A probably benign Het
Chek2 T C 5: 110,848,690 F173L probably damaging Het
Cntnap3 T A 13: 64,781,888 N499I possibly damaging Het
Cog4 T C 8: 110,881,786 L738P probably damaging Het
Cops6 T C 5: 138,163,900 probably null Het
Cpeb1 T A 7: 81,361,669 I175F probably benign Het
Cyp3a16 C T 5: 145,455,895 D174N probably benign Het
Dnah6 T G 6: 73,074,704 I2984L probably benign Het
Dock10 A T 1: 80,586,351 I540N probably damaging Het
Elf5 A G 2: 103,439,233 Y53C probably damaging Het
Elmod2 T C 8: 83,319,457 T164A probably damaging Het
Epn3 A G 11: 94,494,932 probably null Het
Fam151a A T 4: 106,734,004 I15F possibly damaging Het
Gm11115 T A 5: 88,154,050 probably null Het
Gm13103 A G 4: 143,852,814 D323G probably damaging Het
Golga3 T A 5: 110,204,895 I884N probably damaging Het
Gria2 A T 3: 80,692,469 F703I probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gtpbp2 A T 17: 46,164,111 probably null Het
Herc2 T C 7: 56,157,330 S2419P probably damaging Het
Ikbkap T C 4: 56,798,812 probably null Het
Inpp5d T C 1: 87,676,250 probably benign Het
Kdm2b C A 5: 122,961,469 V136F probably damaging Het
Klra2 T A 6: 131,221,876 D234V probably benign Het
Lct A T 1: 128,300,478 S1093T probably benign Het
March9 A G 10: 127,056,689 L310P probably benign Het
Morc1 G T 16: 48,587,124 E668* probably null Het
Mum1 A G 10: 80,232,279 T86A probably benign Het
Nbas A T 12: 13,405,425 L1213F probably damaging Het
Neto1 A G 18: 86,498,748 T397A possibly damaging Het
Oit3 A G 10: 59,429,640 C268R probably damaging Het
Olfr476 A G 7: 107,967,462 T22A probably benign Het
Pcx T C 19: 4,604,495 F312L probably benign Het
Pitx2 T C 3: 129,214,783 probably null Het
Pkhd1l1 G A 15: 44,498,089 probably null Het
Prkch T C 12: 73,702,775 Y381H probably damaging Het
Ptger3 T A 3: 157,567,502 V162E probably damaging Het
Ptgr2 T G 12: 84,313,952 M332R probably damaging Het
Ptprq G T 10: 107,542,653 S2009* probably null Het
Rangrf C T 11: 68,973,688 G11R probably damaging Het
Rbl2 A T 8: 91,096,839 Q465L probably benign Het
Rhbdd1 A T 1: 82,340,659 M88L probably benign Het
Setd2 G A 9: 110,532,717 M13I probably benign Het
Sirpb1a T C 3: 15,379,020 Y384C probably damaging Het
Slc13a1 C T 6: 24,097,612 G439S probably damaging Het
Slc41a1 T A 1: 131,841,149 I239N probably damaging Het
Slit2 T A 5: 48,304,167 C1502S probably damaging Het
Slit3 G A 11: 35,661,292 E888K probably benign Het
Srrm3 G T 5: 135,835,234 R62L probably damaging Het
Synm A G 7: 67,735,583 V777A possibly damaging Het
Trmt13 T A 3: 116,592,215 N31I probably damaging Het
Trpm8 G A 1: 88,361,998 E893K probably damaging Het
Uqcc1 A G 2: 155,851,423 F197S probably damaging Het
Vmn1r67 T A 7: 10,447,671 N287K probably benign Het
Vmn2r44 A T 7: 8,378,099 M265K probably benign Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xdh C A 17: 73,900,551 C937F probably damaging Het
Zfp846 T A 9: 20,593,871 N342K probably benign Het
Other mutations in Polr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Polr1a APN 6 71948486 missense probably benign 0.32
IGL01834:Polr1a APN 6 71948462 missense probably benign
IGL01902:Polr1a APN 6 71963748 missense probably damaging 1.00
IGL02101:Polr1a APN 6 71950802 missense probably benign 0.00
IGL02325:Polr1a APN 6 71920657 missense probably benign 0.38
IGL02398:Polr1a APN 6 71936556 splice site probably benign
IGL02528:Polr1a APN 6 71964717 missense probably benign
IGL02555:Polr1a APN 6 71920457 missense probably damaging 0.98
IGL02613:Polr1a APN 6 71967320 missense probably damaging 1.00
IGL02693:Polr1a APN 6 71963846 splice site probably benign
IGL02892:Polr1a APN 6 71931696 missense possibly damaging 0.70
IGL03059:Polr1a APN 6 71936512 missense probably benign
IGL03174:Polr1a APN 6 71977347 missense possibly damaging 0.82
D4043:Polr1a UTSW 6 71941417 missense possibly damaging 0.92
R0092:Polr1a UTSW 6 71967455 splice site probably benign
R0217:Polr1a UTSW 6 71963703 missense probably benign 0.19
R0267:Polr1a UTSW 6 71974139 missense probably damaging 0.99
R0329:Polr1a UTSW 6 71966416 missense possibly damaging 0.96
R0330:Polr1a UTSW 6 71966416 missense possibly damaging 0.96
R0352:Polr1a UTSW 6 71920763 splice site probably benign
R0411:Polr1a UTSW 6 71978421 missense possibly damaging 0.95
R0446:Polr1a UTSW 6 71950664 critical splice donor site probably null
R0846:Polr1a UTSW 6 71924643 missense probably damaging 1.00
R1035:Polr1a UTSW 6 71967916 missense probably benign
R1294:Polr1a UTSW 6 71912902 missense probably damaging 0.99
R1460:Polr1a UTSW 6 71941384 missense probably damaging 0.99
R1657:Polr1a UTSW 6 71941535 missense probably damaging 1.00
R1846:Polr1a UTSW 6 71976188 missense probably damaging 0.98
R1862:Polr1a UTSW 6 71909203 missense probably damaging 0.96
R1865:Polr1a UTSW 6 71966524 missense probably damaging 1.00
R1903:Polr1a UTSW 6 71967914 missense probably benign 0.02
R1937:Polr1a UTSW 6 71936552 critical splice donor site probably null
R2063:Polr1a UTSW 6 71936285 splice site probably null
R2071:Polr1a UTSW 6 71976074 missense possibly damaging 0.64
R2084:Polr1a UTSW 6 71950809 missense possibly damaging 0.69
R2377:Polr1a UTSW 6 71972826 critical splice donor site probably null
R2410:Polr1a UTSW 6 71974882 missense probably benign
R3001:Polr1a UTSW 6 71965644 missense probably benign 0.02
R3001:Polr1a UTSW 6 71913016 missense probably benign 0.01
R3002:Polr1a UTSW 6 71913016 missense probably benign 0.01
R3002:Polr1a UTSW 6 71965644 missense probably benign 0.02
R3924:Polr1a UTSW 6 71929450 missense probably benign 0.00
R4105:Polr1a UTSW 6 71976191 missense probably damaging 0.98
R4125:Polr1a UTSW 6 71965706 missense probably benign 0.00
R4271:Polr1a UTSW 6 71953022 missense probably benign 0.02
R4440:Polr1a UTSW 6 71950848 missense probably damaging 0.98
R4667:Polr1a UTSW 6 71917821 missense probably benign 0.30
R4769:Polr1a UTSW 6 71950868 missense probably benign 0.01
R4801:Polr1a UTSW 6 71976070 missense probably benign 0.00
R4802:Polr1a UTSW 6 71976070 missense probably benign 0.00
R4828:Polr1a UTSW 6 71966401 missense possibly damaging 0.93
R4911:Polr1a UTSW 6 71909229 missense possibly damaging 0.67
R5071:Polr1a UTSW 6 71931709 missense possibly damaging 0.71
R5165:Polr1a UTSW 6 71967925 missense probably damaging 1.00
R5223:Polr1a UTSW 6 71967907 missense possibly damaging 0.73
R5239:Polr1a UTSW 6 71913037 missense probably damaging 1.00
R5546:Polr1a UTSW 6 71929366 missense possibly damaging 0.64
R5599:Polr1a UTSW 6 71967362 missense possibly damaging 0.95
R5696:Polr1a UTSW 6 71929426 missense probably benign 0.05
R5850:Polr1a UTSW 6 71926683 missense probably benign 0.00
R6274:Polr1a UTSW 6 71954890 splice site probably null
R6578:Polr1a UTSW 6 71976041 missense possibly damaging 0.93
R6660:Polr1a UTSW 6 71967374 missense probably damaging 0.98
R6892:Polr1a UTSW 6 71964712 missense possibly damaging 0.72
R7274:Polr1a UTSW 6 71920516 nonsense probably null
R7291:Polr1a UTSW 6 71941456 missense probably benign 0.02
R7311:Polr1a UTSW 6 71950879 missense possibly damaging 0.53
R7431:Polr1a UTSW 6 71926659 missense probably benign 0.14
R7479:Polr1a UTSW 6 71936297 missense probably damaging 1.00
R7607:Polr1a UTSW 6 71913021 missense probably benign
R7739:Polr1a UTSW 6 71954835 missense possibly damaging 0.94
R7746:Polr1a UTSW 6 71941512 missense probably damaging 1.00
R7764:Polr1a UTSW 6 71953070 missense probably damaging 1.00
R7835:Polr1a UTSW 6 71915142 missense probably benign 0.02
R8029:Polr1a UTSW 6 71912956 nonsense probably null
R8057:Polr1a UTSW 6 71931660 missense possibly damaging 0.95
R8144:Polr1a UTSW 6 71950616 missense probably benign
R8170:Polr1a UTSW 6 71920749 missense probably benign
R8320:Polr1a UTSW 6 71941384 missense probably damaging 0.99
R8328:Polr1a UTSW 6 71920734 missense probably benign
R8331:Polr1a UTSW 6 71976179 missense probably damaging 1.00
R8362:Polr1a UTSW 6 71964667 missense probably benign 0.00
R8511:Polr1a UTSW 6 71920520 missense probably benign 0.01
R8709:Polr1a UTSW 6 71974848 missense probably benign
R8745:Polr1a UTSW 6 71954771 missense probably damaging 1.00
R8784:Polr1a UTSW 6 71950628 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCATTAAGGGCTAGGTTGAGTAAC -3'
(R):5'- TCATGTGCTTCCGGAACAGG -3'

Sequencing Primer
(F):5'- TGACTCCTCAGTGGCTAT -3'
(R):5'- CTTCTCTAGGATCTACACAGAGC -3'
Posted On2018-06-06