Mutagenetix > Incidental Mutation

Incidental Mutation 'R6526:Polr1a'

521841

Institutional Source

Beutler Lab

Gene Symbol

Polr1a

Ensembl Gene

ENSMUSG00000049553

Gene Name

polymerase (RNA) I polypeptide A

Synonyms

RPA194, 3010014K16Rik, 194kDa, mRPA1, Rpo1-4

MMRRC Submission

044652-MU

Accession Numbers

Genbank: NM_009088; MGI: 1096397

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6526 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

71909053-71984935 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 71929443 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 414 (D414E)

Ref Sequence

ENSEMBL: ENSMUSP00000060858 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055296] [ENSMUST00000206556]

AlphaFold

O35134

Predicted Effect

possibly damaging
Transcript: ENSMUST00000055296
AA Change: D414E

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000060858
Gene: ENSMUSG00000049553
AA Change: D414E

Domain	Start	End	E-Value	Type
RPOLA_N	302	649	8.97e-137	SMART
Pfam:RNA_pol_Rpb1_4	846	958	1.3e-26	PFAM
Pfam:RNA_pol_Rpb1_5	965	1669	7e-103	PFAM
low complexity region	1698	1708	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205333

Predicted Effect

probably benign
Transcript: ENSMUST00000206556

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206753

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206823

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.5%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the largest subunit of the RNA polymerase I complex. The encoded protein represents the catalytic subunit of the complex, which transcribes DNA into ribosomal RNA precursors. Defects in this gene are a cause of the Cincinnati type of acrofacial dysostosis. [provided by RefSeq, May 2016]

Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aamp	A	G	1: 74,284,172		probably null	Het
Abcc3	C	T	11: 94,359,372	G975D	probably benign	Het
Abhd13	G	A	8: 9,987,777	G125S	probably damaging	Het
Ache	T	A	5: 137,290,644	L204Q	probably damaging	Het
Acnat2	A	G	4: 49,383,497	S19P	probably benign	Het
Adprh	A	G	16: 38,447,276	Y216H	probably benign	Het
Anapc1	T	A	2: 128,672,135	K429*	probably null	Het
Anxa13	T	C	15: 58,344,957		noncoding transcript	Het
Aprt	A	C	8: 122,576,816	L6W	probably damaging	Het
Arhgef15	T	C	11: 68,949,994	T569A	probably damaging	Het
Atp11a	T	C	8: 12,864,999	L1139P	probably benign	Het
Atp2b4	A	G	1: 133,711,729	S1136P	probably damaging	Het
B9d1	T	A	11: 61,509,097	Y90*	probably null	Het
Btla	G	A	16: 45,239,094	A54T	probably damaging	Het
Cd63	T	C	10: 128,911,489	V35A	probably benign	Het
Chek2	T	C	5: 110,848,690	F173L	probably damaging	Het
Cntnap3	T	A	13: 64,781,888	N499I	possibly damaging	Het
Cog4	T	C	8: 110,881,786	L738P	probably damaging	Het
Cops6	T	C	5: 138,163,900		probably null	Het
Cpeb1	T	A	7: 81,361,669	I175F	probably benign	Het
Cyp3a16	C	T	5: 145,455,895	D174N	probably benign	Het
Dnah6	T	G	6: 73,074,704	I2984L	probably benign	Het
Dock10	A	T	1: 80,586,351	I540N	probably damaging	Het
Elf5	A	G	2: 103,439,233	Y53C	probably damaging	Het
Elmod2	T	C	8: 83,319,457	T164A	probably damaging	Het
Epn3	A	G	11: 94,494,932		probably null	Het
Fam151a	A	T	4: 106,734,004	I15F	possibly damaging	Het
Gm11115	T	A	5: 88,154,050		probably null	Het
Gm13103	A	G	4: 143,852,814	D323G	probably damaging	Het
Golga3	T	A	5: 110,204,895	I884N	probably damaging	Het
Gria2	A	T	3: 80,692,469	F703I	probably damaging	Het
Gtf2h3	C	T	5: 124,584,297	T121I	probably benign	Het
Gtpbp2	A	T	17: 46,164,111		probably null	Het
Herc2	T	C	7: 56,157,330	S2419P	probably damaging	Het
Ikbkap	T	C	4: 56,798,812		probably null	Het
Inpp5d	T	C	1: 87,676,250		probably benign	Het
Kdm2b	C	A	5: 122,961,469	V136F	probably damaging	Het
Klra2	T	A	6: 131,221,876	D234V	probably benign	Het
Lct	A	T	1: 128,300,478	S1093T	probably benign	Het
March9	A	G	10: 127,056,689	L310P	probably benign	Het
Morc1	G	T	16: 48,587,124	E668*	probably null	Het
Mum1	A	G	10: 80,232,279	T86A	probably benign	Het
Nbas	A	T	12: 13,405,425	L1213F	probably damaging	Het
Neto1	A	G	18: 86,498,748	T397A	possibly damaging	Het
Oit3	A	G	10: 59,429,640	C268R	probably damaging	Het
Olfr476	A	G	7: 107,967,462	T22A	probably benign	Het
Pcx	T	C	19: 4,604,495	F312L	probably benign	Het
Pitx2	T	C	3: 129,214,783		probably null	Het
Pkhd1l1	G	A	15: 44,498,089		probably null	Het
Prkch	T	C	12: 73,702,775	Y381H	probably damaging	Het
Ptger3	T	A	3: 157,567,502	V162E	probably damaging	Het
Ptgr2	T	G	12: 84,313,952	M332R	probably damaging	Het
Ptprq	G	T	10: 107,542,653	S2009*	probably null	Het
Rangrf	C	T	11: 68,973,688	G11R	probably damaging	Het
Rbl2	A	T	8: 91,096,839	Q465L	probably benign	Het
Rhbdd1	A	T	1: 82,340,659	M88L	probably benign	Het
Setd2	G	A	9: 110,532,717	M13I	probably benign	Het
Sirpb1a	T	C	3: 15,379,020	Y384C	probably damaging	Het
Slc13a1	C	T	6: 24,097,612	G439S	probably damaging	Het
Slc41a1	T	A	1: 131,841,149	I239N	probably damaging	Het
Slit2	T	A	5: 48,304,167	C1502S	probably damaging	Het
Slit3	G	A	11: 35,661,292	E888K	probably benign	Het
Srrm3	G	T	5: 135,835,234	R62L	probably damaging	Het
Synm	A	G	7: 67,735,583	V777A	possibly damaging	Het
Trmt13	T	A	3: 116,592,215	N31I	probably damaging	Het
Trpm8	G	A	1: 88,361,998	E893K	probably damaging	Het
Uqcc1	A	G	2: 155,851,423	F197S	probably damaging	Het
Vmn1r67	T	A	7: 10,447,671	N287K	probably benign	Het
Vmn2r44	A	T	7: 8,378,099	M265K	probably benign	Het
Wwc1	C	T	11: 35,853,437	E853K	probably benign	Het
Xdh	C	A	17: 73,900,551	C937F	probably damaging	Het
Zfp846	T	A	9: 20,593,871	N342K	probably benign	Het

Other mutations in Polr1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01363:Polr1a	APN	6	71948486	missense	probably benign	0.32
IGL01834:Polr1a	APN	6	71948462	missense	probably benign
IGL01902:Polr1a	APN	6	71963748	missense	probably damaging	1.00
IGL02101:Polr1a	APN	6	71950802	missense	probably benign	0.00
IGL02325:Polr1a	APN	6	71920657	missense	probably benign	0.38
IGL02398:Polr1a	APN	6	71936556	splice site	probably benign
IGL02528:Polr1a	APN	6	71964717	missense	probably benign
IGL02555:Polr1a	APN	6	71920457	missense	probably damaging	0.98
IGL02613:Polr1a	APN	6	71967320	missense	probably damaging	1.00
IGL02693:Polr1a	APN	6	71963846	splice site	probably benign
IGL02892:Polr1a	APN	6	71931696	missense	possibly damaging	0.70
IGL03059:Polr1a	APN	6	71936512	missense	probably benign
IGL03174:Polr1a	APN	6	71977347	missense	possibly damaging	0.82
D4043:Polr1a	UTSW	6	71941417	missense	possibly damaging	0.92
R0092:Polr1a	UTSW	6	71967455	splice site	probably benign
R0217:Polr1a	UTSW	6	71963703	missense	probably benign	0.19
R0267:Polr1a	UTSW	6	71974139	missense	probably damaging	0.99
R0329:Polr1a	UTSW	6	71966416	missense	possibly damaging	0.96
R0330:Polr1a	UTSW	6	71966416	missense	possibly damaging	0.96
R0352:Polr1a	UTSW	6	71920763	splice site	probably benign
R0411:Polr1a	UTSW	6	71978421	missense	possibly damaging	0.95
R0446:Polr1a	UTSW	6	71950664	critical splice donor site	probably null
R0846:Polr1a	UTSW	6	71924643	missense	probably damaging	1.00
R1035:Polr1a	UTSW	6	71967916	missense	probably benign
R1294:Polr1a	UTSW	6	71912902	missense	probably damaging	0.99
R1460:Polr1a	UTSW	6	71941384	missense	probably damaging	0.99
R1657:Polr1a	UTSW	6	71941535	missense	probably damaging	1.00
R1846:Polr1a	UTSW	6	71976188	missense	probably damaging	0.98
R1862:Polr1a	UTSW	6	71909203	missense	probably damaging	0.96
R1865:Polr1a	UTSW	6	71966524	missense	probably damaging	1.00
R1903:Polr1a	UTSW	6	71967914	missense	probably benign	0.02
R1937:Polr1a	UTSW	6	71936552	critical splice donor site	probably null
R2063:Polr1a	UTSW	6	71936285	splice site	probably null
R2071:Polr1a	UTSW	6	71976074	missense	possibly damaging	0.64
R2084:Polr1a	UTSW	6	71950809	missense	possibly damaging	0.69
R2377:Polr1a	UTSW	6	71972826	critical splice donor site	probably null
R2410:Polr1a	UTSW	6	71974882	missense	probably benign
R3001:Polr1a	UTSW	6	71965644	missense	probably benign	0.02
R3001:Polr1a	UTSW	6	71913016	missense	probably benign	0.01
R3002:Polr1a	UTSW	6	71913016	missense	probably benign	0.01
R3002:Polr1a	UTSW	6	71965644	missense	probably benign	0.02
R3924:Polr1a	UTSW	6	71929450	missense	probably benign	0.00
R4105:Polr1a	UTSW	6	71976191	missense	probably damaging	0.98
R4125:Polr1a	UTSW	6	71965706	missense	probably benign	0.00
R4271:Polr1a	UTSW	6	71953022	missense	probably benign	0.02
R4440:Polr1a	UTSW	6	71950848	missense	probably damaging	0.98
R4667:Polr1a	UTSW	6	71917821	missense	probably benign	0.30
R4769:Polr1a	UTSW	6	71950868	missense	probably benign	0.01
R4801:Polr1a	UTSW	6	71976070	missense	probably benign	0.00
R4802:Polr1a	UTSW	6	71976070	missense	probably benign	0.00
R4828:Polr1a	UTSW	6	71966401	missense	possibly damaging	0.93
R4911:Polr1a	UTSW	6	71909229	missense	possibly damaging	0.67
R5071:Polr1a	UTSW	6	71931709	missense	possibly damaging	0.71
R5165:Polr1a	UTSW	6	71967925	missense	probably damaging	1.00
R5223:Polr1a	UTSW	6	71967907	missense	possibly damaging	0.73
R5239:Polr1a	UTSW	6	71913037	missense	probably damaging	1.00
R5546:Polr1a	UTSW	6	71929366	missense	possibly damaging	0.64
R5599:Polr1a	UTSW	6	71967362	missense	possibly damaging	0.95
R5696:Polr1a	UTSW	6	71929426	missense	probably benign	0.05
R5850:Polr1a	UTSW	6	71926683	missense	probably benign	0.00
R6274:Polr1a	UTSW	6	71954890	splice site	probably null
R6578:Polr1a	UTSW	6	71976041	missense	possibly damaging	0.93
R6660:Polr1a	UTSW	6	71967374	missense	probably damaging	0.98
R6892:Polr1a	UTSW	6	71964712	missense	possibly damaging	0.72
R7274:Polr1a	UTSW	6	71920516	nonsense	probably null
R7291:Polr1a	UTSW	6	71941456	missense	probably benign	0.02
R7311:Polr1a	UTSW	6	71950879	missense	possibly damaging	0.53
R7431:Polr1a	UTSW	6	71926659	missense	probably benign	0.14
R7479:Polr1a	UTSW	6	71936297	missense	probably damaging	1.00
R7607:Polr1a	UTSW	6	71913021	missense	probably benign
R7739:Polr1a	UTSW	6	71954835	missense	possibly damaging	0.94
R7746:Polr1a	UTSW	6	71941512	missense	probably damaging	1.00
R7764:Polr1a	UTSW	6	71953070	missense	probably damaging	1.00
R7835:Polr1a	UTSW	6	71915142	missense	probably benign	0.02
R8029:Polr1a	UTSW	6	71912956	nonsense	probably null
R8057:Polr1a	UTSW	6	71931660	missense	possibly damaging	0.95
R8144:Polr1a	UTSW	6	71950616	missense	probably benign
R8170:Polr1a	UTSW	6	71920749	missense	probably benign
R8320:Polr1a	UTSW	6	71941384	missense	probably damaging	0.99
R8328:Polr1a	UTSW	6	71920734	missense	probably benign
R8331:Polr1a	UTSW	6	71976179	missense	probably damaging	1.00
R8362:Polr1a	UTSW	6	71964667	missense	probably benign	0.00
R8511:Polr1a	UTSW	6	71920520	missense	probably benign	0.01
R8709:Polr1a	UTSW	6	71974848	missense	probably benign
R8745:Polr1a	UTSW	6	71954771	missense	probably damaging	1.00
R8784:Polr1a	UTSW	6	71950628	missense	probably benign
R9055:Polr1a	UTSW	6	71915069	missense	possibly damaging	0.46
R9088:Polr1a	UTSW	6	71931783	missense	probably benign	0.26
R9211:Polr1a	UTSW	6	71966537	missense	probably damaging	1.00
R9228:Polr1a	UTSW	6	71954771	missense	probably damaging	1.00
R9240:Polr1a	UTSW	6	71963677	nonsense	probably null
R9267:Polr1a	UTSW	6	71965558	missense	probably benign
R9302:Polr1a	UTSW	6	71924699	critical splice donor site	probably null
R9744:Polr1a	UTSW	6	71929388	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TCATTAAGGGCTAGGTTGAGTAAC -3'
(R):5'- TCATGTGCTTCCGGAACAGG -3'

Sequencing Primer
(F):5'- TGACTCCTCAGTGGCTAT -3'
(R):5'- CTTCTCTAGGATCTACACAGAGC -3'

Posted On

2018-06-06