Incidental Mutation 'R6526:Vmn2r44'
ID521848
Institutional Source Beutler Lab
Gene Symbol Vmn2r44
Ensembl Gene ENSMUSG00000094098
Gene Namevomeronasal 2, receptor 44
SynonymsEG434113
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R6526 (G1)
Quality Score172.009
Status Not validated
Chromosome7
Chromosomal Location8366502-8383354 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8378099 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 265 (M265K)
Ref Sequence ENSEMBL: ENSMUSP00000132467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166499]
Predicted Effect probably benign
Transcript: ENSMUST00000166499
AA Change: M265K

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000132467
Gene: ENSMUSG00000094098
AA Change: M265K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.5e-34 PFAM
Pfam:NCD3G 512 565 3.8e-20 PFAM
Pfam:7tm_3 598 833 5.7e-55 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,284,172 probably null Het
Abcc3 C T 11: 94,359,372 G975D probably benign Het
Abhd13 G A 8: 9,987,777 G125S probably damaging Het
Ache T A 5: 137,290,644 L204Q probably damaging Het
Acnat2 A G 4: 49,383,497 S19P probably benign Het
Adprh A G 16: 38,447,276 Y216H probably benign Het
Anapc1 T A 2: 128,672,135 K429* probably null Het
Anxa13 T C 15: 58,344,957 noncoding transcript Het
Aprt A C 8: 122,576,816 L6W probably damaging Het
Arhgef15 T C 11: 68,949,994 T569A probably damaging Het
Atp11a T C 8: 12,864,999 L1139P probably benign Het
Atp2b4 A G 1: 133,711,729 S1136P probably damaging Het
B9d1 T A 11: 61,509,097 Y90* probably null Het
Btla G A 16: 45,239,094 A54T probably damaging Het
Cd63 T C 10: 128,911,489 V35A probably benign Het
Chek2 T C 5: 110,848,690 F173L probably damaging Het
Cntnap3 T A 13: 64,781,888 N499I possibly damaging Het
Cog4 T C 8: 110,881,786 L738P probably damaging Het
Cops6 T C 5: 138,163,900 probably null Het
Cpeb1 T A 7: 81,361,669 I175F probably benign Het
Cyp3a16 C T 5: 145,455,895 D174N probably benign Het
Dnah6 T G 6: 73,074,704 I2984L probably benign Het
Dock10 A T 1: 80,586,351 I540N probably damaging Het
Elf5 A G 2: 103,439,233 Y53C probably damaging Het
Elmod2 T C 8: 83,319,457 T164A probably damaging Het
Epn3 A G 11: 94,494,932 probably null Het
Fam151a A T 4: 106,734,004 I15F possibly damaging Het
Gm11115 T A 5: 88,154,050 probably null Het
Gm13103 A G 4: 143,852,814 D323G probably damaging Het
Golga3 T A 5: 110,204,895 I884N probably damaging Het
Gria2 A T 3: 80,692,469 F703I probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gtpbp2 A T 17: 46,164,111 probably null Het
Herc2 T C 7: 56,157,330 S2419P probably damaging Het
Ikbkap T C 4: 56,798,812 probably null Het
Inpp5d T C 1: 87,676,250 probably benign Het
Kdm2b C A 5: 122,961,469 V136F probably damaging Het
Klra2 T A 6: 131,221,876 D234V probably benign Het
Lct A T 1: 128,300,478 S1093T probably benign Het
March9 A G 10: 127,056,689 L310P probably benign Het
Morc1 G T 16: 48,587,124 E668* probably null Het
Mum1 A G 10: 80,232,279 T86A probably benign Het
Nbas A T 12: 13,405,425 L1213F probably damaging Het
Neto1 A G 18: 86,498,748 T397A possibly damaging Het
Oit3 A G 10: 59,429,640 C268R probably damaging Het
Olfr476 A G 7: 107,967,462 T22A probably benign Het
Pcx T C 19: 4,604,495 F312L probably benign Het
Pitx2 T C 3: 129,214,783 probably null Het
Pkhd1l1 G A 15: 44,498,089 probably null Het
Polr1a C A 6: 71,929,443 D414E possibly damaging Het
Prkch T C 12: 73,702,775 Y381H probably damaging Het
Ptger3 T A 3: 157,567,502 V162E probably damaging Het
Ptgr2 T G 12: 84,313,952 M332R probably damaging Het
Ptprq G T 10: 107,542,653 S2009* probably null Het
Rangrf C T 11: 68,973,688 G11R probably damaging Het
Rbl2 A T 8: 91,096,839 Q465L probably benign Het
Rhbdd1 A T 1: 82,340,659 M88L probably benign Het
Setd2 G A 9: 110,532,717 M13I probably benign Het
Sirpb1a T C 3: 15,379,020 Y384C probably damaging Het
Slc13a1 C T 6: 24,097,612 G439S probably damaging Het
Slc41a1 T A 1: 131,841,149 I239N probably damaging Het
Slit2 T A 5: 48,304,167 C1502S probably damaging Het
Slit3 G A 11: 35,661,292 E888K probably benign Het
Srrm3 G T 5: 135,835,234 R62L probably damaging Het
Synm A G 7: 67,735,583 V777A possibly damaging Het
Trmt13 T A 3: 116,592,215 N31I probably damaging Het
Trpm8 G A 1: 88,361,998 E893K probably damaging Het
Uqcc1 A G 2: 155,851,423 F197S probably damaging Het
Vmn1r67 T A 7: 10,447,671 N287K probably benign Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xdh C A 17: 73,900,551 C937F probably damaging Het
Zfp846 T A 9: 20,593,871 N342K probably benign Het
Other mutations in Vmn2r44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01650:Vmn2r44 APN 7 8380104 critical splice donor site probably null
IGL01723:Vmn2r44 APN 7 8377916 missense probably damaging 0.97
IGL01767:Vmn2r44 APN 7 8380238 missense probably benign 0.00
IGL02161:Vmn2r44 APN 7 8377815 missense possibly damaging 0.94
IGL02299:Vmn2r44 APN 7 8377816 missense probably benign
IGL02418:Vmn2r44 APN 7 8377865 missense probably damaging 1.00
IGL02829:Vmn2r44 APN 7 8377880 missense possibly damaging 0.94
IGL02851:Vmn2r44 APN 7 8383051 missense probably damaging 1.00
IGL03080:Vmn2r44 APN 7 8383245 utr 5 prime probably benign
R1471:Vmn2r44 UTSW 7 8377883 missense probably damaging 0.99
R1789:Vmn2r44 UTSW 7 8380123 missense possibly damaging 0.64
R1932:Vmn2r44 UTSW 7 8367982 missense probably benign 0.04
R2354:Vmn2r44 UTSW 7 8370640 missense probably damaging 0.99
R4009:Vmn2r44 UTSW 7 8377988 missense possibly damaging 0.82
R4130:Vmn2r44 UTSW 7 8367919 missense probably damaging 1.00
R4790:Vmn2r44 UTSW 7 8367950 missense probably damaging 1.00
R4854:Vmn2r44 UTSW 7 8380301 missense possibly damaging 0.94
R4887:Vmn2r44 UTSW 7 8377986 missense probably benign 0.19
R4888:Vmn2r44 UTSW 7 8377986 missense probably benign 0.19
R5484:Vmn2r44 UTSW 7 8380124 missense possibly damaging 0.69
R6110:Vmn2r44 UTSW 7 8378006 missense probably damaging 1.00
R6357:Vmn2r44 UTSW 7 8370658 missense probably benign 0.01
R7083:Vmn2r44 UTSW 7 8378370 missense probably benign 0.44
R7087:Vmn2r44 UTSW 7 8378367 missense probably benign 0.02
R7115:Vmn2r44 UTSW 7 8367528 nonsense probably null
R7125:Vmn2r44 UTSW 7 8367942 missense probably damaging 1.00
R7258:Vmn2r44 UTSW 7 8377849 missense probably damaging 1.00
R7359:Vmn2r44 UTSW 7 8367539 missense probably benign 0.30
R7494:Vmn2r44 UTSW 7 8383123 nonsense probably null
R7766:Vmn2r44 UTSW 7 8368220 missense probably damaging 1.00
R7777:Vmn2r44 UTSW 7 8378315 missense possibly damaging 0.81
R8184:Vmn2r44 UTSW 7 8368228 nonsense probably null
Z1177:Vmn2r44 UTSW 7 8367977 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAGATGGAACCATGTCTGTAC -3'
(R):5'- CTGGATTGGCCTTGTCATCC -3'

Sequencing Primer
(F):5'- GATGGAACCATGTCTGTACAAAATC -3'
(R):5'- TCATCCCAGATGATGATCAAGG -3'
Posted On2018-06-06