Incidental Mutation 'R6526:Cpeb1'
ID521856
Institutional Source Beutler Lab
Gene Symbol Cpeb1
Ensembl Gene ENSMUSG00000025586
Gene Namecytoplasmic polyadenylation element binding protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6526 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location81347026-81455465 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 81361669 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 175 (I175F)
Ref Sequence ENSEMBL: ENSMUSP00000137079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098331] [ENSMUST00000130310] [ENSMUST00000178892]
Predicted Effect probably benign
Transcript: ENSMUST00000098331
AA Change: I174F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095936
Gene: ENSMUSG00000025586
AA Change: I174F

DomainStartEndE-ValueType
low complexity region 112 126 N/A INTRINSIC
low complexity region 176 195 N/A INTRINSIC
RRM 311 386 2.6e-4 SMART
RRM_2 430 506 2.7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130310
AA Change: I169F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120139
Gene: ENSMUSG00000025586
AA Change: I169F

DomainStartEndE-ValueType
low complexity region 107 121 N/A INTRINSIC
low complexity region 171 190 N/A INTRINSIC
RRM 306 376 1.35e-1 SMART
RRM 420 496 6.36e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153419
Predicted Effect probably benign
Transcript: ENSMUST00000178892
AA Change: I175F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137079
Gene: ENSMUSG00000025586
AA Change: I175F

DomainStartEndE-ValueType
Pfam:CEBP1_N 1 307 2.5e-153 PFAM
RRM 312 387 6.25e-2 SMART
RRM 431 507 6.36e-1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytoplasmic polyadenylation element binding protein family. This highly conserved protein binds to a specific RNA sequence, called the cytoplasmic polyadenylation element, found in the 3' untranslated region of some mRNAs. The encoded protein functions in both the cytoplasm and the nucleus. It is involved in the regulation of mRNA translation, as well as processing of the 3' untranslated region, and may play a role in cell proliferation and tumorigenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null allele are viable and overtly normal but display a developmental arrest of both female and male germ cells at the pachytene stage, defective synaptonemal complex formation, and impaired neuronal synaptic plasticity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,284,172 probably null Het
Abcc3 C T 11: 94,359,372 G975D probably benign Het
Abhd13 G A 8: 9,987,777 G125S probably damaging Het
Ache T A 5: 137,290,644 L204Q probably damaging Het
Acnat2 A G 4: 49,383,497 S19P probably benign Het
Adprh A G 16: 38,447,276 Y216H probably benign Het
Anapc1 T A 2: 128,672,135 K429* probably null Het
Anxa13 T C 15: 58,344,957 noncoding transcript Het
Aprt A C 8: 122,576,816 L6W probably damaging Het
Arhgef15 T C 11: 68,949,994 T569A probably damaging Het
Atp11a T C 8: 12,864,999 L1139P probably benign Het
Atp2b4 A G 1: 133,711,729 S1136P probably damaging Het
B9d1 T A 11: 61,509,097 Y90* probably null Het
Btla G A 16: 45,239,094 A54T probably damaging Het
Cd63 T C 10: 128,911,489 V35A probably benign Het
Chek2 T C 5: 110,848,690 F173L probably damaging Het
Cntnap3 T A 13: 64,781,888 N499I possibly damaging Het
Cog4 T C 8: 110,881,786 L738P probably damaging Het
Cops6 T C 5: 138,163,900 probably null Het
Cyp3a16 C T 5: 145,455,895 D174N probably benign Het
Dnah6 T G 6: 73,074,704 I2984L probably benign Het
Dock10 A T 1: 80,586,351 I540N probably damaging Het
Elf5 A G 2: 103,439,233 Y53C probably damaging Het
Elmod2 T C 8: 83,319,457 T164A probably damaging Het
Epn3 A G 11: 94,494,932 probably null Het
Fam151a A T 4: 106,734,004 I15F possibly damaging Het
Gm11115 T A 5: 88,154,050 probably null Het
Gm13103 A G 4: 143,852,814 D323G probably damaging Het
Golga3 T A 5: 110,204,895 I884N probably damaging Het
Gria2 A T 3: 80,692,469 F703I probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gtpbp2 A T 17: 46,164,111 probably null Het
Herc2 T C 7: 56,157,330 S2419P probably damaging Het
Ikbkap T C 4: 56,798,812 probably null Het
Inpp5d T C 1: 87,676,250 probably benign Het
Kdm2b C A 5: 122,961,469 V136F probably damaging Het
Klra2 T A 6: 131,221,876 D234V probably benign Het
Lct A T 1: 128,300,478 S1093T probably benign Het
March9 A G 10: 127,056,689 L310P probably benign Het
Morc1 G T 16: 48,587,124 E668* probably null Het
Mum1 A G 10: 80,232,279 T86A probably benign Het
Nbas A T 12: 13,405,425 L1213F probably damaging Het
Neto1 A G 18: 86,498,748 T397A possibly damaging Het
Oit3 A G 10: 59,429,640 C268R probably damaging Het
Olfr476 A G 7: 107,967,462 T22A probably benign Het
Pcx T C 19: 4,604,495 F312L probably benign Het
Pitx2 T C 3: 129,214,783 probably null Het
Pkhd1l1 G A 15: 44,498,089 probably null Het
Polr1a C A 6: 71,929,443 D414E possibly damaging Het
Prkch T C 12: 73,702,775 Y381H probably damaging Het
Ptger3 T A 3: 157,567,502 V162E probably damaging Het
Ptgr2 T G 12: 84,313,952 M332R probably damaging Het
Ptprq G T 10: 107,542,653 S2009* probably null Het
Rangrf C T 11: 68,973,688 G11R probably damaging Het
Rbl2 A T 8: 91,096,839 Q465L probably benign Het
Rhbdd1 A T 1: 82,340,659 M88L probably benign Het
Setd2 G A 9: 110,532,717 M13I probably benign Het
Sirpb1a T C 3: 15,379,020 Y384C probably damaging Het
Slc13a1 C T 6: 24,097,612 G439S probably damaging Het
Slc41a1 T A 1: 131,841,149 I239N probably damaging Het
Slit2 T A 5: 48,304,167 C1502S probably damaging Het
Slit3 G A 11: 35,661,292 E888K probably benign Het
Srrm3 G T 5: 135,835,234 R62L probably damaging Het
Synm A G 7: 67,735,583 V777A possibly damaging Het
Trmt13 T A 3: 116,592,215 N31I probably damaging Het
Trpm8 G A 1: 88,361,998 E893K probably damaging Het
Uqcc1 A G 2: 155,851,423 F197S probably damaging Het
Vmn1r67 T A 7: 10,447,671 N287K probably benign Het
Vmn2r44 A T 7: 8,378,099 M265K probably benign Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xdh C A 17: 73,900,551 C937F probably damaging Het
Zfp846 T A 9: 20,593,871 N342K probably benign Het
Other mutations in Cpeb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Cpeb1 APN 7 81372181 missense probably benign
IGL01598:Cpeb1 APN 7 81361801 missense probably benign
IGL02214:Cpeb1 APN 7 81372057 missense possibly damaging 0.89
IGL02527:Cpeb1 APN 7 81359887 missense probably damaging 1.00
IGL02878:Cpeb1 APN 7 81357326 missense probably damaging 1.00
IGL03065:Cpeb1 APN 7 81436290 missense probably benign 0.39
IGL03305:Cpeb1 APN 7 81361716 missense probably benign 0.16
PIT4458001:Cpeb1 UTSW 7 81348432 missense probably damaging 1.00
R0391:Cpeb1 UTSW 7 81361725 missense possibly damaging 0.89
R0711:Cpeb1 UTSW 7 81351870 missense probably benign 0.01
R1626:Cpeb1 UTSW 7 81436247 missense probably damaging 1.00
R1723:Cpeb1 UTSW 7 81436226 missense probably benign 0.29
R1902:Cpeb1 UTSW 7 81372119 missense probably benign 0.03
R4614:Cpeb1 UTSW 7 81436270 missense possibly damaging 0.46
R4773:Cpeb1 UTSW 7 81355947 missense probably benign
R5256:Cpeb1 UTSW 7 81351839 missense probably damaging 1.00
R5750:Cpeb1 UTSW 7 81436351 missense probably benign 0.01
R5927:Cpeb1 UTSW 7 81361680 missense possibly damaging 0.69
R6000:Cpeb1 UTSW 7 81361680 missense possibly damaging 0.69
R8150:Cpeb1 UTSW 7 81357404 missense probably damaging 0.99
RF005:Cpeb1 UTSW 7 81361806 missense possibly damaging 0.79
X0067:Cpeb1 UTSW 7 81359727 critical splice donor site probably null
Z1176:Cpeb1 UTSW 7 81359728 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAGGCACCCCTTTCAATCTC -3'
(R):5'- AGAGGTTAAATCTGCCTTGGG -3'

Sequencing Primer
(F):5'- CTAAGACAGATACTGTAGCATCTTCC -3'
(R):5'- AAGAGGTTATGAGCATTCCTTTTC -3'
Posted On2018-06-06