Incidental Mutation 'R6526:Olfr476'
ID521858
Institutional Source Beutler Lab
Gene Symbol Olfr476
Ensembl Gene ENSMUSG00000095301
Gene Nameolfactory receptor 476
SynonymsMOR204-3, GA_x6K02T2PBJ9-10296787-10297719
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R6526 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location107964803-107969514 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107967462 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 22 (T22A)
Ref Sequence ENSEMBL: ENSMUSP00000149760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077249] [ENSMUST00000217173]
Predicted Effect probably benign
Transcript: ENSMUST00000077249
AA Change: T22A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000076485
Gene: ENSMUSG00000095301
AA Change: T22A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.7e-51 PFAM
Pfam:7tm_1 41 290 4.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217173
AA Change: T22A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,284,172 probably null Het
Abcc3 C T 11: 94,359,372 G975D probably benign Het
Abhd13 G A 8: 9,987,777 G125S probably damaging Het
Ache T A 5: 137,290,644 L204Q probably damaging Het
Acnat2 A G 4: 49,383,497 S19P probably benign Het
Adprh A G 16: 38,447,276 Y216H probably benign Het
Anapc1 T A 2: 128,672,135 K429* probably null Het
Anxa13 T C 15: 58,344,957 noncoding transcript Het
Aprt A C 8: 122,576,816 L6W probably damaging Het
Arhgef15 T C 11: 68,949,994 T569A probably damaging Het
Atp11a T C 8: 12,864,999 L1139P probably benign Het
Atp2b4 A G 1: 133,711,729 S1136P probably damaging Het
B9d1 T A 11: 61,509,097 Y90* probably null Het
Btla G A 16: 45,239,094 A54T probably damaging Het
Cd63 T C 10: 128,911,489 V35A probably benign Het
Chek2 T C 5: 110,848,690 F173L probably damaging Het
Cntnap3 T A 13: 64,781,888 N499I possibly damaging Het
Cog4 T C 8: 110,881,786 L738P probably damaging Het
Cops6 T C 5: 138,163,900 probably null Het
Cpeb1 T A 7: 81,361,669 I175F probably benign Het
Cyp3a16 C T 5: 145,455,895 D174N probably benign Het
Dnah6 T G 6: 73,074,704 I2984L probably benign Het
Dock10 A T 1: 80,586,351 I540N probably damaging Het
Elf5 A G 2: 103,439,233 Y53C probably damaging Het
Elmod2 T C 8: 83,319,457 T164A probably damaging Het
Epn3 A G 11: 94,494,932 probably null Het
Fam151a A T 4: 106,734,004 I15F possibly damaging Het
Gm11115 T A 5: 88,154,050 probably null Het
Gm13103 A G 4: 143,852,814 D323G probably damaging Het
Golga3 T A 5: 110,204,895 I884N probably damaging Het
Gria2 A T 3: 80,692,469 F703I probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gtpbp2 A T 17: 46,164,111 probably null Het
Herc2 T C 7: 56,157,330 S2419P probably damaging Het
Ikbkap T C 4: 56,798,812 probably null Het
Inpp5d T C 1: 87,676,250 probably benign Het
Kdm2b C A 5: 122,961,469 V136F probably damaging Het
Klra2 T A 6: 131,221,876 D234V probably benign Het
Lct A T 1: 128,300,478 S1093T probably benign Het
March9 A G 10: 127,056,689 L310P probably benign Het
Morc1 G T 16: 48,587,124 E668* probably null Het
Mum1 A G 10: 80,232,279 T86A probably benign Het
Nbas A T 12: 13,405,425 L1213F probably damaging Het
Neto1 A G 18: 86,498,748 T397A possibly damaging Het
Oit3 A G 10: 59,429,640 C268R probably damaging Het
Pcx T C 19: 4,604,495 F312L probably benign Het
Pitx2 T C 3: 129,214,783 probably null Het
Pkhd1l1 G A 15: 44,498,089 probably null Het
Polr1a C A 6: 71,929,443 D414E possibly damaging Het
Prkch T C 12: 73,702,775 Y381H probably damaging Het
Ptger3 T A 3: 157,567,502 V162E probably damaging Het
Ptgr2 T G 12: 84,313,952 M332R probably damaging Het
Ptprq G T 10: 107,542,653 S2009* probably null Het
Rangrf C T 11: 68,973,688 G11R probably damaging Het
Rbl2 A T 8: 91,096,839 Q465L probably benign Het
Rhbdd1 A T 1: 82,340,659 M88L probably benign Het
Setd2 G A 9: 110,532,717 M13I probably benign Het
Sirpb1a T C 3: 15,379,020 Y384C probably damaging Het
Slc13a1 C T 6: 24,097,612 G439S probably damaging Het
Slc41a1 T A 1: 131,841,149 I239N probably damaging Het
Slit2 T A 5: 48,304,167 C1502S probably damaging Het
Slit3 G A 11: 35,661,292 E888K probably benign Het
Srrm3 G T 5: 135,835,234 R62L probably damaging Het
Synm A G 7: 67,735,583 V777A possibly damaging Het
Trmt13 T A 3: 116,592,215 N31I probably damaging Het
Trpm8 G A 1: 88,361,998 E893K probably damaging Het
Uqcc1 A G 2: 155,851,423 F197S probably damaging Het
Vmn1r67 T A 7: 10,447,671 N287K probably benign Het
Vmn2r44 A T 7: 8,378,099 M265K probably benign Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xdh C A 17: 73,900,551 C937F probably damaging Het
Zfp846 T A 9: 20,593,871 N342K probably benign Het
Other mutations in Olfr476
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Olfr476 APN 7 107967534 missense probably damaging 1.00
IGL01403:Olfr476 APN 7 107967621 missense possibly damaging 0.64
IGL01564:Olfr476 APN 7 107967991 missense probably benign 0.11
IGL01615:Olfr476 APN 7 107967937 missense probably damaging 1.00
IGL01777:Olfr476 APN 7 107967502 missense probably damaging 1.00
IGL01999:Olfr476 APN 7 107967468 missense probably benign
IGL02239:Olfr476 APN 7 107968047 missense probably damaging 1.00
R0636:Olfr476 UTSW 7 107967472 missense probably benign 0.00
R1986:Olfr476 UTSW 7 107967670 missense probably benign
R5109:Olfr476 UTSW 7 107967897 missense probably benign 0.06
R6363:Olfr476 UTSW 7 107967750 missense possibly damaging 0.57
R6907:Olfr476 UTSW 7 107968252 missense probably damaging 1.00
R7063:Olfr476 UTSW 7 107968204 missense probably benign
R7218:Olfr476 UTSW 7 107967667 missense probably benign
R7240:Olfr476 UTSW 7 107968188 missense probably benign 0.42
R7444:Olfr476 UTSW 7 107967604 missense probably damaging 0.99
R7939:Olfr476 UTSW 7 107967779 nonsense probably null
R8060:Olfr476 UTSW 7 107967405 missense probably benign
X0025:Olfr476 UTSW 7 107968188 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- AATCCCCAGTTCTTCAAAGCATAG -3'
(R):5'- GCAGCTACAGAGAGTACCAG -3'

Sequencing Primer
(F):5'- ATATTTGTATTTGGTCAAAGGAAGGG -3'
(R):5'- GCTACAGAGAGTACCAGTCTATTTCC -3'
Posted On2018-06-06