Incidental Mutation 'R6554:Mfsd4b5'
ID521861
Institutional Source Beutler Lab
Gene Symbol Mfsd4b5
Ensembl Gene ENSMUSG00000038528
Gene Namemajor facilitator superfamily domain containing 4B5
SynonymsBC021785
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6554 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location39958061-39986646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39986432 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 32 (T32S)
Ref Sequence ENSEMBL: ENSMUSP00000073304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045524] [ENSMUST00000073618] [ENSMUST00000164566] [ENSMUST00000170579]
Predicted Effect probably benign
Transcript: ENSMUST00000045524
SMART Domains Protein: ENSMUSP00000040341
Gene: ENSMUSG00000038528

DomainStartEndE-ValueType
transmembrane domain 45 64 N/A INTRINSIC
transmembrane domain 71 89 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073618
AA Change: T32S

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000073304
Gene: ENSMUSG00000038528
AA Change: T32S

DomainStartEndE-ValueType
transmembrane domain 39 61 N/A INTRINSIC
transmembrane domain 76 95 N/A INTRINSIC
transmembrane domain 102 120 N/A INTRINSIC
transmembrane domain 124 141 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164566
AA Change: T32S

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000130944
Gene: ENSMUSG00000038528
AA Change: T32S

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 76 95 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170579
AA Change: T32S

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000126439
Gene: ENSMUSG00000038528
AA Change: T32S

DomainStartEndE-ValueType
Pfam:MFS_1 39 395 7.2e-15 PFAM
Pfam:TrkH 170 325 1.4e-9 PFAM
transmembrane domain 423 445 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,641,287 R180C probably damaging Het
Ces1b C A 8: 93,064,991 V327L probably benign Het
Cps1 C T 1: 67,174,469 R787* probably null Het
D430042O09Rik C T 7: 125,850,742 R993C probably damaging Het
Dmrt2 C T 19: 25,677,948 P304S probably damaging Het
Dopey2 A G 16: 93,760,458 D429G probably benign Het
Dync1h1 T A 12: 110,649,848 M3111K probably benign Het
Dync2h1 A G 9: 7,037,699 V3393A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam184a T C 10: 53,640,967 D1007G possibly damaging Het
Flt3 A C 5: 147,375,735 L132W probably damaging Het
Gm14322 G A 2: 177,768,427 S60N possibly damaging Het
Gm34653 C A 2: 34,839,264 S358R probably benign Het
Gm35339 A G 15: 76,354,978 D85G possibly damaging Het
Kcnj16 T A 11: 111,025,305 Y264* probably null Het
Klkb1 T A 8: 45,273,554 I471F probably damaging Het
Lrfn4 T C 19: 4,613,886 T207A probably damaging Het
Mtbp A G 15: 55,567,249 D234G probably damaging Het
Nfix T C 8: 84,727,650 T218A possibly damaging Het
Nsd3 A T 8: 25,662,875 E410D probably damaging Het
Olfr1284 C T 2: 111,379,159 S53F possibly damaging Het
Olfr259 A T 2: 87,107,626 S254T probably benign Het
Reln T C 5: 21,896,840 Y3364C probably damaging Het
Selplg G A 5: 113,820,149 P32L probably benign Het
Serpina1d A T 12: 103,764,803 H305Q probably benign Het
Skint8 G A 4: 111,927,216 C13Y probably benign Het
Smc4 G A 3: 69,029,515 V863I probably benign Het
Spdl1 T G 11: 34,822,570 N224T possibly damaging Het
Sprr1b T G 3: 92,437,113 Q152P possibly damaging Het
St6gal1 A G 16: 23,321,655 N192S probably benign Het
Tbc1d8 T C 1: 39,406,822 N96S probably damaging Het
Tbccd1 A T 16: 22,822,124 I501K probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Unk T C 11: 116,051,459 I293T probably damaging Het
Vmn2r61 A G 7: 42,276,715 E548G probably damaging Het
Wdr61 A T 9: 54,727,645 I88N probably damaging Het
Zeb2 A T 2: 44,997,512 V496E probably damaging Het
Other mutations in Mfsd4b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Mfsd4b5 APN 10 39970727 missense probably damaging 1.00
R1138:Mfsd4b5 UTSW 10 39975154 missense probably damaging 1.00
R1166:Mfsd4b5 UTSW 10 39970423 missense probably damaging 1.00
R1668:Mfsd4b5 UTSW 10 39973691 missense probably damaging 0.98
R1718:Mfsd4b5 UTSW 10 39975203 missense probably benign 0.09
R3977:Mfsd4b5 UTSW 10 39974708 intron probably benign
R5015:Mfsd4b5 UTSW 10 39974762 missense probably benign 0.03
R5080:Mfsd4b5 UTSW 10 39970574 missense probably damaging 1.00
R5191:Mfsd4b5 UTSW 10 39970672 missense probably damaging 1.00
R6706:Mfsd4b5 UTSW 10 39986417 missense probably benign 0.17
R7667:Mfsd4b5 UTSW 10 39974800 missense probably benign 0.01
R7750:Mfsd4b5 UTSW 10 39970255 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGTAAGGTTTGCTGCAGTTG -3'
(R):5'- GGAGAAGTCTTCTGGTCAGAC -3'

Sequencing Primer
(F):5'- CTGCAGTTGGAAAATATTAGGGTC -3'
(R):5'- TCAGACAGAACAGGGGCTC -3'
Posted On2018-06-06