Incidental Mutation 'R6554:Serpina1d'
ID521867
Institutional Source Beutler Lab
Gene Symbol Serpina1d
Ensembl Gene ENSMUSG00000071177
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 1D
SynonymsSpi1-4, PI4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6554 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location103763594-103773592 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103764803 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 305 (H305Q)
Ref Sequence ENSEMBL: ENSMUSP00000077909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078869] [ENSMUST00000164454]
Predicted Effect probably benign
Transcript: ENSMUST00000078869
AA Change: H305Q

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000077909
Gene: ENSMUSG00000071177
AA Change: H305Q

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
SERPIN 53 410 3.17e-200 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164454
SMART Domains Protein: ENSMUSP00000127266
Gene: ENSMUSG00000071178

DomainStartEndE-ValueType
SERPIN 53 410 7.62e-203 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,641,287 R180C probably damaging Het
Ces1b C A 8: 93,064,991 V327L probably benign Het
Cps1 C T 1: 67,174,469 R787* probably null Het
D430042O09Rik C T 7: 125,850,742 R993C probably damaging Het
Dmrt2 C T 19: 25,677,948 P304S probably damaging Het
Dopey2 A G 16: 93,760,458 D429G probably benign Het
Dync1h1 T A 12: 110,649,848 M3111K probably benign Het
Dync2h1 A G 9: 7,037,699 V3393A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam184a T C 10: 53,640,967 D1007G possibly damaging Het
Flt3 A C 5: 147,375,735 L132W probably damaging Het
Gm14322 G A 2: 177,768,427 S60N possibly damaging Het
Gm34653 C A 2: 34,839,264 S358R probably benign Het
Gm35339 A G 15: 76,354,978 D85G possibly damaging Het
Kcnj16 T A 11: 111,025,305 Y264* probably null Het
Klkb1 T A 8: 45,273,554 I471F probably damaging Het
Lrfn4 T C 19: 4,613,886 T207A probably damaging Het
Mfsd4b5 T A 10: 39,986,432 T32S probably benign Het
Mtbp A G 15: 55,567,249 D234G probably damaging Het
Nfix T C 8: 84,727,650 T218A possibly damaging Het
Nsd3 A T 8: 25,662,875 E410D probably damaging Het
Olfr1284 C T 2: 111,379,159 S53F possibly damaging Het
Olfr259 A T 2: 87,107,626 S254T probably benign Het
Reln T C 5: 21,896,840 Y3364C probably damaging Het
Selplg G A 5: 113,820,149 P32L probably benign Het
Skint8 G A 4: 111,927,216 C13Y probably benign Het
Smc4 G A 3: 69,029,515 V863I probably benign Het
Spdl1 T G 11: 34,822,570 N224T possibly damaging Het
Sprr1b T G 3: 92,437,113 Q152P possibly damaging Het
St6gal1 A G 16: 23,321,655 N192S probably benign Het
Tbc1d8 T C 1: 39,406,822 N96S probably damaging Het
Tbccd1 A T 16: 22,822,124 I501K probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Unk T C 11: 116,051,459 I293T probably damaging Het
Vmn2r61 A G 7: 42,276,715 E548G probably damaging Het
Wdr61 A T 9: 54,727,645 I88N probably damaging Het
Zeb2 A T 2: 44,997,512 V496E probably damaging Het
Other mutations in Serpina1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Serpina1d APN 12 103763734 missense probably benign 0.00
IGL02175:Serpina1d APN 12 103765696 splice site probably null
IGL02336:Serpina1d APN 12 103764796 nonsense probably null
IGL03260:Serpina1d APN 12 103763849 missense probably damaging 0.98
R0119:Serpina1d UTSW 12 103765757 missense probably damaging 1.00
R0299:Serpina1d UTSW 12 103765757 missense probably damaging 1.00
R0348:Serpina1d UTSW 12 103763775 missense probably benign 0.05
R0499:Serpina1d UTSW 12 103765757 missense probably damaging 1.00
R1086:Serpina1d UTSW 12 103763787 missense probably benign
R1864:Serpina1d UTSW 12 103767997 missense probably benign 0.21
R1883:Serpina1d UTSW 12 103765778 missense possibly damaging 0.64
R1884:Serpina1d UTSW 12 103765778 missense possibly damaging 0.64
R3731:Serpina1d UTSW 12 103767905 missense possibly damaging 0.63
R3973:Serpina1d UTSW 12 103767848 missense probably benign 0.01
R3976:Serpina1d UTSW 12 103767848 missense probably benign 0.01
R4227:Serpina1d UTSW 12 103767481 missense probably benign 0.03
R4783:Serpina1d UTSW 12 103767824 missense possibly damaging 0.87
R5672:Serpina1d UTSW 12 103763842 missense possibly damaging 0.69
R5764:Serpina1d UTSW 12 103765821 missense probably benign 0.00
R6244:Serpina1d UTSW 12 103764828 unclassified probably null
R6314:Serpina1d UTSW 12 103764700 missense probably benign 0.39
R6548:Serpina1d UTSW 12 103767552 missense probably damaging 1.00
R6953:Serpina1d UTSW 12 103767730 missense probably benign 0.00
R7106:Serpina1d UTSW 12 103765721 missense probably benign 0.01
R7390:Serpina1d UTSW 12 103767778 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CAGTCACACAGGACATCAGG -3'
(R):5'- GTTGAGCTTTGAAATCCCACTG -3'

Sequencing Primer
(F):5'- ATCAGGACATTGCCATGGTC -3'
(R):5'- TCTGCTGGAAGGTTACAATAGAAAAG -3'
Posted On2018-06-06