Incidental Mutation 'R6554:St6gal1'
ID521875
Institutional Source Beutler Lab
Gene Symbol St6gal1
Ensembl Gene ENSMUSG00000022885
Gene Namebeta galactoside alpha 2,6 sialyltransferase 1
SynonymsSt6Gal-I, Siat1, ST6Gal I
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R6554 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location23224740-23360350 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23321655 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 192 (N192S)
Ref Sequence ENSEMBL: ENSMUSP00000136206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023601] [ENSMUST00000115335] [ENSMUST00000128050] [ENSMUST00000178797]
Predicted Effect probably benign
Transcript: ENSMUST00000023601
AA Change: N192S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023601
Gene: ENSMUSG00000022885
AA Change: N192S

DomainStartEndE-ValueType
transmembrane domain 9 26 N/A INTRINSIC
Pfam:Glyco_transf_29 127 389 2.3e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115335
AA Change: N192S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110992
Gene: ENSMUSG00000022885
AA Change: N192S

DomainStartEndE-ValueType
transmembrane domain 9 26 N/A INTRINSIC
Pfam:Glyco_transf_29 140 383 8.3e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152449
Predicted Effect probably benign
Transcript: ENSMUST00000178797
AA Change: N192S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000136206
Gene: ENSMUSG00000022885
AA Change: N192S

DomainStartEndE-ValueType
transmembrane domain 9 26 N/A INTRINSIC
Pfam:Glyco_transf_29 127 389 2.3e-63 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: This gene encodes a member of glycosyltransferase family 29. The encoded protein is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The protein, which is normally found in the Golgi but can be proteolytically processed to a soluble form, is involved in the generation of the cell-surface carbohydrate determinants and differentiation antigens HB-6, CD75, and CD76. This gene has been incorrectly referred to as CD75. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on chromosome 15. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in altered terminal glycosylation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,641,287 R180C probably damaging Het
Ces1b C A 8: 93,064,991 V327L probably benign Het
Cps1 C T 1: 67,174,469 R787* probably null Het
D430042O09Rik C T 7: 125,850,742 R993C probably damaging Het
Dmrt2 C T 19: 25,677,948 P304S probably damaging Het
Dopey2 A G 16: 93,760,458 D429G probably benign Het
Dync1h1 T A 12: 110,649,848 M3111K probably benign Het
Dync2h1 A G 9: 7,037,699 V3393A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam184a T C 10: 53,640,967 D1007G possibly damaging Het
Flt3 A C 5: 147,375,735 L132W probably damaging Het
Gm14322 G A 2: 177,768,427 S60N possibly damaging Het
Gm34653 C A 2: 34,839,264 S358R probably benign Het
Gm35339 A G 15: 76,354,978 D85G possibly damaging Het
Kcnj16 T A 11: 111,025,305 Y264* probably null Het
Klkb1 T A 8: 45,273,554 I471F probably damaging Het
Lrfn4 T C 19: 4,613,886 T207A probably damaging Het
Mfsd4b5 T A 10: 39,986,432 T32S probably benign Het
Mtbp A G 15: 55,567,249 D234G probably damaging Het
Nfix T C 8: 84,727,650 T218A possibly damaging Het
Nsd3 A T 8: 25,662,875 E410D probably damaging Het
Olfr1284 C T 2: 111,379,159 S53F possibly damaging Het
Olfr259 A T 2: 87,107,626 S254T probably benign Het
Reln T C 5: 21,896,840 Y3364C probably damaging Het
Selplg G A 5: 113,820,149 P32L probably benign Het
Serpina1d A T 12: 103,764,803 H305Q probably benign Het
Skint8 G A 4: 111,927,216 C13Y probably benign Het
Smc4 G A 3: 69,029,515 V863I probably benign Het
Spdl1 T G 11: 34,822,570 N224T possibly damaging Het
Sprr1b T G 3: 92,437,113 Q152P possibly damaging Het
Tbc1d8 T C 1: 39,406,822 N96S probably damaging Het
Tbccd1 A T 16: 22,822,124 I501K probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Unk T C 11: 116,051,459 I293T probably damaging Het
Vmn2r61 A G 7: 42,276,715 E548G probably damaging Het
Wdr61 A T 9: 54,727,645 I88N probably damaging Het
Zeb2 A T 2: 44,997,512 V496E probably damaging Het
Other mutations in St6gal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:St6gal1 APN 16 23356392 splice site probably benign
IGL01667:St6gal1 APN 16 23321424 missense probably benign 0.00
IGL01783:St6gal1 APN 16 23321555 missense probably benign 0.29
IGL02996:St6gal1 APN 16 23321154 missense probably damaging 0.98
R0049:St6gal1 UTSW 16 23321141 missense probably damaging 1.00
R0049:St6gal1 UTSW 16 23321141 missense probably damaging 1.00
R0295:St6gal1 UTSW 16 23356203 splice site probably benign
R1290:St6gal1 UTSW 16 23321661 missense probably benign 0.03
R1352:St6gal1 UTSW 16 23321651 missense probably damaging 1.00
R1817:St6gal1 UTSW 16 23321333 nonsense probably null
R1911:St6gal1 UTSW 16 23321633 missense probably damaging 0.99
R2113:St6gal1 UTSW 16 23328417 missense probably damaging 0.98
R4591:St6gal1 UTSW 16 23321294 missense probably benign 0.00
R5761:St6gal1 UTSW 16 23321055 utr 5 prime probably benign
R6925:St6gal1 UTSW 16 23356213 missense probably damaging 1.00
R7658:St6gal1 UTSW 16 23356228 missense probably damaging 1.00
R7740:St6gal1 UTSW 16 23321035 splice site probably benign
R8017:St6gal1 UTSW 16 23357835 missense probably benign 0.01
R8018:St6gal1 UTSW 16 23357835 missense probably benign 0.01
R8019:St6gal1 UTSW 16 23357835 missense probably benign 0.01
R8044:St6gal1 UTSW 16 23357835 missense probably benign 0.01
R8122:St6gal1 UTSW 16 23354894 missense probably benign 0.00
R8123:St6gal1 UTSW 16 23357835 missense probably benign 0.01
R8124:St6gal1 UTSW 16 23357835 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAAGTTCAGCGTAGAGGCG -3'
(R):5'- ATTCCCCAGTCAATCCTCGG -3'

Sequencing Primer
(F):5'- GCTGCGCTGCCACCTTC -3'
(R):5'- GAAATGTCTCCATGAGATCCAGCTG -3'
Posted On2018-06-06