Incidental Mutation 'R6526:Cog4'
ID521876
Institutional Source Beutler Lab
Gene Symbol Cog4
Ensembl Gene ENSMUSG00000031753
Gene Namecomponent of oligomeric golgi complex 4
SynonymsD8Ertd515e
MMRRC Submission
Accession Numbers

Genbank: NM_133973; MGI: 2142808  

Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R6526 (G1)
Quality Score195.009
Status Validated
Chromosome8
Chromosomal Location110846600-110882227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110881786 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 738 (L738P)
Ref Sequence ENSEMBL: ENSMUSP00000133297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034203] [ENSMUST00000041382] [ENSMUST00000165867] [ENSMUST00000172542] [ENSMUST00000174398] [ENSMUST00000174679] [ENSMUST00000212971]
Predicted Effect probably damaging
Transcript: ENSMUST00000034203
AA Change: L760P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034203
Gene: ENSMUSG00000031753
AA Change: L760P

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
coiled coil region 34 77 N/A INTRINSIC
Blast:Cog4 81 178 1e-53 BLAST
Cog4 188 498 1.81e-140 SMART
Pfam:RINT1_TIP1 536 773 3.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041382
SMART Domains Protein: ENSMUSP00000039271
Gene: ENSMUSG00000033703

DomainStartEndE-ValueType
low complexity region 22 37 N/A INTRINSIC
Pfam:Fucokinase 94 496 1.7e-101 PFAM
low complexity region 807 821 N/A INTRINSIC
Pfam:GHMP_kinases_N 827 894 3.6e-9 PFAM
Pfam:GHMP_kinases_C 970 1052 1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165867
AA Change: L687P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128518
Gene: ENSMUSG00000031753
AA Change: L687P

DomainStartEndE-ValueType
Blast:Cog4 8 105 6e-54 BLAST
Cog4 115 425 1.81e-140 SMART
PDB:3HR0|B 452 712 1e-174 PDB
Blast:DIL 621 702 6e-38 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172497
Predicted Effect probably benign
Transcript: ENSMUST00000172542
SMART Domains Protein: ENSMUSP00000133283
Gene: ENSMUSG00000031753

DomainStartEndE-ValueType
Pfam:COG4 1 156 6.3e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174398
AA Change: L738P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133297
Gene: ENSMUSG00000031753
AA Change: L738P

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
coiled coil region 33 76 N/A INTRINSIC
Blast:Cog4 80 177 9e-54 BLAST
Cog4 187 497 1.81e-140 SMART
PDB:3HR0|B 524 763 1e-153 PDB
Blast:DIL 672 753 7e-38 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174679
SMART Domains Protein: ENSMUSP00000133458
Gene: ENSMUSG00000031753

DomainStartEndE-ValueType
Blast:Cog4 27 174 5e-60 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180679
Predicted Effect probably benign
Transcript: ENSMUST00000212971
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of an oligomeric protein complex involved in the structure and function of the Golgi apparatus. Defects in this gene may be a cause of congenital disorder of glycosylation type IIj. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2010]
Allele List at MGI

All alleles(13) : Gene trapped(13)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,284,172 probably null Het
Abcc3 C T 11: 94,359,372 G975D probably benign Het
Abhd13 G A 8: 9,987,777 G125S probably damaging Het
Ache T A 5: 137,290,644 L204Q probably damaging Het
Acnat2 A G 4: 49,383,497 S19P probably benign Het
Adprh A G 16: 38,447,276 Y216H probably benign Het
Anapc1 T A 2: 128,672,135 K429* probably null Het
Anxa13 T C 15: 58,344,957 noncoding transcript Het
Aprt A C 8: 122,576,816 L6W probably damaging Het
Arhgef15 T C 11: 68,949,994 T569A probably damaging Het
Atp11a T C 8: 12,864,999 L1139P probably benign Het
Atp2b4 A G 1: 133,711,729 S1136P probably damaging Het
B9d1 T A 11: 61,509,097 Y90* probably null Het
Btla G A 16: 45,239,094 A54T probably damaging Het
Cd63 T C 10: 128,911,489 V35A probably benign Het
Chek2 T C 5: 110,848,690 F173L probably damaging Het
Cntnap3 T A 13: 64,781,888 N499I possibly damaging Het
Cops6 T C 5: 138,163,900 probably null Het
Cpeb1 T A 7: 81,361,669 I175F probably benign Het
Cyp3a16 C T 5: 145,455,895 D174N probably benign Het
Dnah6 T G 6: 73,074,704 I2984L probably benign Het
Dock10 A T 1: 80,586,351 I540N probably damaging Het
Elf5 A G 2: 103,439,233 Y53C probably damaging Het
Elmod2 T C 8: 83,319,457 T164A probably damaging Het
Epn3 A G 11: 94,494,932 probably null Het
Fam151a A T 4: 106,734,004 I15F possibly damaging Het
Gm11115 T A 5: 88,154,050 probably null Het
Gm13103 A G 4: 143,852,814 D323G probably damaging Het
Golga3 T A 5: 110,204,895 I884N probably damaging Het
Gria2 A T 3: 80,692,469 F703I probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gtpbp2 A T 17: 46,164,111 probably null Het
Herc2 T C 7: 56,157,330 S2419P probably damaging Het
Ikbkap T C 4: 56,798,812 probably null Het
Inpp5d T C 1: 87,676,250 probably benign Het
Kdm2b C A 5: 122,961,469 V136F probably damaging Het
Klra2 T A 6: 131,221,876 D234V probably benign Het
Lct A T 1: 128,300,478 S1093T probably benign Het
March9 A G 10: 127,056,689 L310P probably benign Het
Morc1 G T 16: 48,587,124 E668* probably null Het
Mum1 A G 10: 80,232,279 T86A probably benign Het
Nbas A T 12: 13,405,425 L1213F probably damaging Het
Neto1 A G 18: 86,498,748 T397A possibly damaging Het
Oit3 A G 10: 59,429,640 C268R probably damaging Het
Olfr476 A G 7: 107,967,462 T22A probably benign Het
Pcx T C 19: 4,604,495 F312L probably benign Het
Pitx2 T C 3: 129,214,783 probably null Het
Pkhd1l1 G A 15: 44,498,089 probably null Het
Polr1a C A 6: 71,929,443 D414E possibly damaging Het
Prkch T C 12: 73,702,775 Y381H probably damaging Het
Ptger3 T A 3: 157,567,502 V162E probably damaging Het
Ptgr2 T G 12: 84,313,952 M332R probably damaging Het
Ptprq G T 10: 107,542,653 S2009* probably null Het
Rangrf C T 11: 68,973,688 G11R probably damaging Het
Rbl2 A T 8: 91,096,839 Q465L probably benign Het
Rhbdd1 A T 1: 82,340,659 M88L probably benign Het
Setd2 G A 9: 110,532,717 M13I probably benign Het
Sirpb1a T C 3: 15,379,020 Y384C probably damaging Het
Slc13a1 C T 6: 24,097,612 G439S probably damaging Het
Slc41a1 T A 1: 131,841,149 I239N probably damaging Het
Slit2 T A 5: 48,304,167 C1502S probably damaging Het
Slit3 G A 11: 35,661,292 E888K probably benign Het
Srrm3 G T 5: 135,835,234 R62L probably damaging Het
Synm A G 7: 67,735,583 V777A possibly damaging Het
Trmt13 T A 3: 116,592,215 N31I probably damaging Het
Trpm8 G A 1: 88,361,998 E893K probably damaging Het
Uqcc1 A G 2: 155,851,423 F197S probably damaging Het
Vmn1r67 T A 7: 10,447,671 N287K probably benign Het
Vmn2r44 A T 7: 8,378,099 M265K probably benign Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xdh C A 17: 73,900,551 C937F probably damaging Het
Zfp846 T A 9: 20,593,871 N342K probably benign Het
Other mutations in Cog4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Cog4 APN 8 110866085 missense probably benign 0.44
IGL01631:Cog4 APN 8 110881840 missense probably damaging 1.00
IGL01756:Cog4 APN 8 110853759 nonsense probably null
IGL02850:Cog4 APN 8 110866589 missense possibly damaging 0.46
IGL02932:Cog4 APN 8 110852433 missense probably benign 0.16
IGL03232:Cog4 APN 8 110880682 splice site probably null
Deminimis UTSW 8 110881480 missense probably damaging 0.98
PIT4362001:Cog4 UTSW 8 110866672 missense probably damaging 1.00
R0350:Cog4 UTSW 8 110853696 missense possibly damaging 0.73
R1368:Cog4 UTSW 8 110858525 unclassified probably benign
R1531:Cog4 UTSW 8 110879721 missense probably benign 0.30
R2110:Cog4 UTSW 8 110858582 missense possibly damaging 0.62
R2112:Cog4 UTSW 8 110858582 missense possibly damaging 0.62
R2867:Cog4 UTSW 8 110866659 intron probably benign
R4239:Cog4 UTSW 8 110858612 missense probably damaging 0.98
R4867:Cog4 UTSW 8 110866610 missense probably damaging 1.00
R4967:Cog4 UTSW 8 110852283 splice site probably null
R5124:Cog4 UTSW 8 110847193 missense probably damaging 1.00
R5655:Cog4 UTSW 8 110863307 missense probably damaging 1.00
R6024:Cog4 UTSW 8 110881480 missense probably damaging 0.98
R6347:Cog4 UTSW 8 110880643 missense probably damaging 1.00
R6475:Cog4 UTSW 8 110880894 missense possibly damaging 0.74
R6542:Cog4 UTSW 8 110851362 missense probably damaging 1.00
R6545:Cog4 UTSW 8 110880945 missense probably damaging 1.00
R7248:Cog4 UTSW 8 110882202 missense unknown
R7292:Cog4 UTSW 8 110881828 missense probably damaging 1.00
R7356:Cog4 UTSW 8 110849866 critical splice acceptor site probably null
R7440:Cog4 UTSW 8 110879706 missense probably benign 0.06
R7751:Cog4 UTSW 8 110880968 missense probably damaging 1.00
R8170:Cog4 UTSW 8 110866031 missense probably damaging 0.98
R8181:Cog4 UTSW 8 110852085 splice site probably null
Z1177:Cog4 UTSW 8 110879015 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCACAGTTCTACAAGGCACC -3'
(R):5'- TTCCTGGTTTCCATGCAGTG -3'

Sequencing Primer
(F):5'- AGGCACCCCCTTCCTATATG -3'
(R):5'- TAGCCTGGACCTTTGGCTGAC -3'
Posted On2018-06-06