Incidental Mutation 'R6526:Mum1'
ID521886
Institutional Source Beutler Lab
Gene Symbol Mum1
Ensembl Gene ENSMUSG00000020156
Gene Namemelanoma associated antigen (mutated) 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6526 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location80226434-80243903 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80232279 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 86 (T86A)
Ref Sequence ENSEMBL: ENSMUSP00000117519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020365] [ENSMUST00000130260]
Predicted Effect probably benign
Transcript: ENSMUST00000020365
AA Change: T86A

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000020365
Gene: ENSMUSG00000020156
AA Change: T86A

DomainStartEndE-ValueType
low complexity region 127 140 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
Pfam:PWWP 381 458 2.9e-8 PFAM
low complexity region 671 682 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125784
Predicted Effect probably benign
Transcript: ENSMUST00000130260
AA Change: T86A

PolyPhen 2 Score 0.179 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000117519
Gene: ENSMUSG00000020156
AA Change: T86A

DomainStartEndE-ValueType
low complexity region 127 140 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135598
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139431
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146538
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,284,172 probably null Het
Abcc3 C T 11: 94,359,372 G975D probably benign Het
Abhd13 G A 8: 9,987,777 G125S probably damaging Het
Ache T A 5: 137,290,644 L204Q probably damaging Het
Acnat2 A G 4: 49,383,497 S19P probably benign Het
Adprh A G 16: 38,447,276 Y216H probably benign Het
Anapc1 T A 2: 128,672,135 K429* probably null Het
Anxa13 T C 15: 58,344,957 noncoding transcript Het
Aprt A C 8: 122,576,816 L6W probably damaging Het
Arhgef15 T C 11: 68,949,994 T569A probably damaging Het
Atp11a T C 8: 12,864,999 L1139P probably benign Het
Atp2b4 A G 1: 133,711,729 S1136P probably damaging Het
B9d1 T A 11: 61,509,097 Y90* probably null Het
Btla G A 16: 45,239,094 A54T probably damaging Het
Cd63 T C 10: 128,911,489 V35A probably benign Het
Chek2 T C 5: 110,848,690 F173L probably damaging Het
Cntnap3 T A 13: 64,781,888 N499I possibly damaging Het
Cog4 T C 8: 110,881,786 L738P probably damaging Het
Cops6 T C 5: 138,163,900 probably null Het
Cpeb1 T A 7: 81,361,669 I175F probably benign Het
Cyp3a16 C T 5: 145,455,895 D174N probably benign Het
Dnah6 T G 6: 73,074,704 I2984L probably benign Het
Dock10 A T 1: 80,586,351 I540N probably damaging Het
Elf5 A G 2: 103,439,233 Y53C probably damaging Het
Elmod2 T C 8: 83,319,457 T164A probably damaging Het
Epn3 A G 11: 94,494,932 probably null Het
Fam151a A T 4: 106,734,004 I15F possibly damaging Het
Gm11115 T A 5: 88,154,050 probably null Het
Gm13103 A G 4: 143,852,814 D323G probably damaging Het
Golga3 T A 5: 110,204,895 I884N probably damaging Het
Gria2 A T 3: 80,692,469 F703I probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gtpbp2 A T 17: 46,164,111 probably null Het
Herc2 T C 7: 56,157,330 S2419P probably damaging Het
Ikbkap T C 4: 56,798,812 probably null Het
Inpp5d T C 1: 87,676,250 probably benign Het
Kdm2b C A 5: 122,961,469 V136F probably damaging Het
Klra2 T A 6: 131,221,876 D234V probably benign Het
Lct A T 1: 128,300,478 S1093T probably benign Het
March9 A G 10: 127,056,689 L310P probably benign Het
Morc1 G T 16: 48,587,124 E668* probably null Het
Nbas A T 12: 13,405,425 L1213F probably damaging Het
Neto1 A G 18: 86,498,748 T397A possibly damaging Het
Oit3 A G 10: 59,429,640 C268R probably damaging Het
Olfr476 A G 7: 107,967,462 T22A probably benign Het
Pcx T C 19: 4,604,495 F312L probably benign Het
Pitx2 T C 3: 129,214,783 probably null Het
Pkhd1l1 G A 15: 44,498,089 probably null Het
Polr1a C A 6: 71,929,443 D414E possibly damaging Het
Prkch T C 12: 73,702,775 Y381H probably damaging Het
Ptger3 T A 3: 157,567,502 V162E probably damaging Het
Ptgr2 T G 12: 84,313,952 M332R probably damaging Het
Ptprq G T 10: 107,542,653 S2009* probably null Het
Rangrf C T 11: 68,973,688 G11R probably damaging Het
Rbl2 A T 8: 91,096,839 Q465L probably benign Het
Rhbdd1 A T 1: 82,340,659 M88L probably benign Het
Setd2 G A 9: 110,532,717 M13I probably benign Het
Sirpb1a T C 3: 15,379,020 Y384C probably damaging Het
Slc13a1 C T 6: 24,097,612 G439S probably damaging Het
Slc41a1 T A 1: 131,841,149 I239N probably damaging Het
Slit2 T A 5: 48,304,167 C1502S probably damaging Het
Slit3 G A 11: 35,661,292 E888K probably benign Het
Srrm3 G T 5: 135,835,234 R62L probably damaging Het
Synm A G 7: 67,735,583 V777A possibly damaging Het
Trmt13 T A 3: 116,592,215 N31I probably damaging Het
Trpm8 G A 1: 88,361,998 E893K probably damaging Het
Uqcc1 A G 2: 155,851,423 F197S probably damaging Het
Vmn1r67 T A 7: 10,447,671 N287K probably benign Het
Vmn2r44 A T 7: 8,378,099 M265K probably benign Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xdh C A 17: 73,900,551 C937F probably damaging Het
Zfp846 T A 9: 20,593,871 N342K probably benign Het
Other mutations in Mum1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Mum1 APN 10 80234329 critical splice donor site probably null
IGL02152:Mum1 APN 10 80239978 missense probably damaging 1.00
IGL02541:Mum1 APN 10 80228439 critical splice donor site probably null
IGL02562:Mum1 APN 10 80238895 missense probably damaging 1.00
IGL02609:Mum1 APN 10 80230083 missense probably damaging 0.99
R0242:Mum1 UTSW 10 80234258 missense probably benign 0.02
R0242:Mum1 UTSW 10 80234258 missense probably benign 0.02
R0378:Mum1 UTSW 10 80238879 splice site probably null
R0441:Mum1 UTSW 10 80229025 missense probably damaging 1.00
R0675:Mum1 UTSW 10 80230080 missense probably damaging 0.99
R1558:Mum1 UTSW 10 80232944 missense probably benign 0.05
R1612:Mum1 UTSW 10 80233055 unclassified probably benign
R1873:Mum1 UTSW 10 80232608 missense possibly damaging 0.93
R2247:Mum1 UTSW 10 80240425 missense probably damaging 1.00
R3905:Mum1 UTSW 10 80238316 missense probably damaging 1.00
R3907:Mum1 UTSW 10 80238316 missense probably damaging 1.00
R3908:Mum1 UTSW 10 80238316 missense probably damaging 1.00
R4468:Mum1 UTSW 10 80240736 intron probably benign
R4657:Mum1 UTSW 10 80233014 missense probably benign 0.00
R4989:Mum1 UTSW 10 80232868 missense probably benign 0.01
R5030:Mum1 UTSW 10 80240375 intron probably benign
R5133:Mum1 UTSW 10 80232868 missense probably benign 0.01
R5134:Mum1 UTSW 10 80232868 missense probably benign 0.01
R5239:Mum1 UTSW 10 80228421 nonsense probably null
R6119:Mum1 UTSW 10 80229031 missense probably benign 0.25
R6253:Mum1 UTSW 10 80233014 missense probably benign 0.00
R7421:Mum1 UTSW 10 80232753 missense probably benign 0.38
R8116:Mum1 UTSW 10 80240397 missense probably damaging 1.00
R8252:Mum1 UTSW 10 80241860 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TATCTAAAGTCATAGCCCTGAGTG -3'
(R):5'- ACCACGGCTTGACCATCTTC -3'

Sequencing Primer
(F):5'- GCCCTGAGTGATTATATAGCCATC -3'
(R):5'- TTGACCATCTTCACCGAGGAGAG -3'
Posted On2018-06-06