Incidental Mutation 'R6557:Olfr1275'
ID521887
Institutional Source Beutler Lab
Gene Symbol Olfr1275
Ensembl Gene ENSMUSG00000074966
Gene Nameolfactory receptor 1275
SynonymsGA_x6K02T2Q125-72283260-72282322, MOR245-18
MMRRC Submission
Accession Numbers

Genbank: NM_001011795; MGI: 3031109

Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R6557 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location111230360-111235286 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111231631 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 54 (H54R)
Ref Sequence ENSEMBL: ENSMUSP00000150515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028577] [ENSMUST00000099620] [ENSMUST00000216421] [ENSMUST00000217539]
Predicted Effect probably benign
Transcript: ENSMUST00000028577
SMART Domains Protein: ENSMUSP00000028577
Gene: ENSMUSG00000027157

DomainStartEndE-ValueType
ANK 78 107 1.61e-4 SMART
ANK 111 140 3.6e-2 SMART
ANK 144 173 4.89e-4 SMART
ANK 177 206 4.03e-5 SMART
ANK 210 239 8.72e-1 SMART
Blast:ANK 243 272 4e-12 BLAST
low complexity region 460 472 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099620
AA Change: H54R

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000097215
Gene: ENSMUSG00000074966
AA Change: H54R

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 9.8e-37 PFAM
Pfam:7tm_1 41 287 5.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216421
AA Change: H54R

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000217539
AA Change: H54R

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cxcl15 C T 5: 90,794,566 probably benign Het
Dysf A G 6: 84,186,384 D1580G probably damaging Het
Gpc5 A T 14: 115,092,534 probably benign Het
Greb1 T C 12: 16,710,383 I575V probably benign Het
Hecw1 T C 13: 14,316,646 E174G possibly damaging Het
Hip1 T C 5: 135,428,719 D300G possibly damaging Het
Ica1l T C 1: 59,997,625 T336A probably benign Het
Ikzf3 C T 11: 98,516,881 A45T probably benign Het
Krtap16-1 T C 11: 99,985,130 S483G possibly damaging Het
Lamb2 T C 9: 108,488,400 L1394P probably damaging Het
Liph T A 16: 21,983,920 E133V possibly damaging Het
Mamdc2 A G 19: 23,310,845 S610P possibly damaging Het
Map10 T C 8: 125,670,252 V128A probably damaging Het
Mon2 C A 10: 123,016,402 C1022F probably damaging Het
Nfatc3 T C 8: 106,119,354 S1039P probably benign Het
Nov A T 15: 54,747,927 R153* probably null Het
Scaper T C 9: 55,550,850 N879S probably benign Het
Sec24d T C 3: 123,343,087 Y490H probably damaging Het
Tdrd5 T C 1: 156,300,721 K137R probably benign Het
Topaz1 A G 9: 122,748,895 N290S probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfp638 C A 6: 83,930,110 P419Q probably damaging Het
Zzz3 T A 3: 152,428,460 L385Q probably damaging Het
Other mutations in Olfr1275
AlleleSourceChrCoordTypePredicted EffectPPH Score
3-1:Olfr1275 UTSW 2 111231463 missense possibly damaging 0.77
R0477:Olfr1275 UTSW 2 111231664 missense probably benign 0.00
R1209:Olfr1275 UTSW 2 111231613 missense probably damaging 1.00
R1780:Olfr1275 UTSW 2 111231698 missense probably benign
R5386:Olfr1275 UTSW 2 111231194 missense probably benign 0.05
R5637:Olfr1275 UTSW 2 111231111 missense probably benign 0.26
R5819:Olfr1275 UTSW 2 111230959 missense probably damaging 1.00
R6007:Olfr1275 UTSW 2 111230930 missense probably benign 0.30
R6414:Olfr1275 UTSW 2 111231152 unclassified probably null
R6864:Olfr1275 UTSW 2 111231197 missense probably benign 0.26
R7035:Olfr1275 UTSW 2 111231439 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCACATATCTGTCCCAG -3'
(R):5'- GATCTGAATAACTGAAGACAGCTC -3'

Sequencing Primer
(F):5'- CACATATCTGTCCCAGGCCATGG -3'
(R):5'- CTGAATAACTGAAGACAGCTCAAATG -3'
Posted On2018-06-06