Incidental Mutation 'R6557:Sec24d'
ID 521889
Institutional Source Beutler Lab
Gene Symbol Sec24d
Ensembl Gene ENSMUSG00000039234
Gene Name SEC24 homolog D, COPII coat complex component
Synonyms LOC383951, 2310020L09Rik
MMRRC Submission 044681-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6557 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 123061104-123159290 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 123136736 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 490 (Y490H)
Ref Sequence ENSEMBL: ENSMUSP00000035823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047923]
AlphaFold Q6NXL1
Predicted Effect probably damaging
Transcript: ENSMUST00000047923
AA Change: Y490H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035823
Gene: ENSMUSG00000039234
AA Change: Y490H

DomainStartEndE-ValueType
low complexity region 46 71 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 136 160 N/A INTRINSIC
low complexity region 197 222 N/A INTRINSIC
low complexity region 238 256 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 360 398 1.8e-16 PFAM
Pfam:Sec23_trunk 437 681 3.6e-88 PFAM
Pfam:Sec23_BS 686 770 2e-20 PFAM
Pfam:Sec23_helical 783 884 1e-27 PFAM
Pfam:Gelsolin 899 974 4.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197291
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. This gene product is implicated in the shaping of the vesicle, and also in cargo selection and concentration. Mutations in this gene have been associated with Cole-Carpenter syndrome, a disorder affecting bone formation, resulting in craniofacial malformations and bones that break easily. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. A hypomorphic gene trap allele results in lethality during organogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccn3 A T 15: 54,611,323 (GRCm39) R153* probably null Het
Cxcl15 C T 5: 90,942,425 (GRCm39) probably benign Het
Dysf A G 6: 84,163,366 (GRCm39) D1580G probably damaging Het
Gpc5 A T 14: 115,329,966 (GRCm39) probably benign Het
Greb1 T C 12: 16,760,384 (GRCm39) I575V probably benign Het
Hecw1 T C 13: 14,491,231 (GRCm39) E174G possibly damaging Het
Hip1 T C 5: 135,457,573 (GRCm39) D300G possibly damaging Het
Ica1l T C 1: 60,036,784 (GRCm39) T336A probably benign Het
Ikzf3 C T 11: 98,407,707 (GRCm39) A45T probably benign Het
Krtap16-1 T C 11: 99,875,956 (GRCm39) S483G possibly damaging Het
Lamb2 T C 9: 108,365,599 (GRCm39) L1394P probably damaging Het
Liph T A 16: 21,802,670 (GRCm39) E133V possibly damaging Het
Mamdc2 A G 19: 23,288,209 (GRCm39) S610P possibly damaging Het
Map10 T C 8: 126,396,991 (GRCm39) V128A probably damaging Het
Mon2 C A 10: 122,852,307 (GRCm39) C1022F probably damaging Het
Nfatc3 T C 8: 106,845,986 (GRCm39) S1039P probably benign Het
Or4f52 T C 2: 111,061,976 (GRCm39) H54R probably benign Het
Scaper T C 9: 55,458,134 (GRCm39) N879S probably benign Het
Tdrd5 T C 1: 156,128,291 (GRCm39) K137R probably benign Het
Topaz1 A G 9: 122,577,960 (GRCm39) N290S probably benign Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Zfp638 C A 6: 83,907,092 (GRCm39) P419Q probably damaging Het
Zzz3 T A 3: 152,134,097 (GRCm39) L385Q probably damaging Het
Other mutations in Sec24d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Sec24d APN 3 123,143,658 (GRCm39) missense probably benign 0.00
IGL01621:Sec24d APN 3 123,087,807 (GRCm39) critical splice acceptor site probably null
IGL01866:Sec24d APN 3 123,087,244 (GRCm39) nonsense probably null
IGL02064:Sec24d APN 3 123,137,463 (GRCm39) splice site probably benign
IGL02125:Sec24d APN 3 123,152,607 (GRCm39) missense probably damaging 1.00
IGL02173:Sec24d APN 3 123,147,330 (GRCm39) missense probably damaging 1.00
IGL03239:Sec24d APN 3 123,130,138 (GRCm39) missense probably benign 0.00
Scanty UTSW 3 123,148,596 (GRCm39) missense probably damaging 1.00
3-1:Sec24d UTSW 3 123,147,279 (GRCm39) missense possibly damaging 0.94
PIT4531001:Sec24d UTSW 3 123,136,827 (GRCm39) missense probably damaging 1.00
R0008:Sec24d UTSW 3 123,144,525 (GRCm39) splice site probably benign
R0838:Sec24d UTSW 3 123,099,485 (GRCm39) missense probably benign 0.08
R1775:Sec24d UTSW 3 123,130,166 (GRCm39) missense probably damaging 1.00
R1895:Sec24d UTSW 3 123,147,043 (GRCm39) missense probably benign 0.04
R1946:Sec24d UTSW 3 123,147,043 (GRCm39) missense probably benign 0.04
R2238:Sec24d UTSW 3 123,143,543 (GRCm39) splice site probably null
R2504:Sec24d UTSW 3 123,147,255 (GRCm39) missense possibly damaging 0.69
R2846:Sec24d UTSW 3 123,144,395 (GRCm39) missense probably damaging 0.98
R2895:Sec24d UTSW 3 123,136,800 (GRCm39) missense probably damaging 1.00
R3428:Sec24d UTSW 3 123,137,572 (GRCm39) splice site probably benign
R4573:Sec24d UTSW 3 123,152,519 (GRCm39) missense probably damaging 1.00
R4668:Sec24d UTSW 3 123,149,423 (GRCm39) missense probably damaging 0.98
R4706:Sec24d UTSW 3 123,149,427 (GRCm39) missense possibly damaging 0.80
R4896:Sec24d UTSW 3 123,148,596 (GRCm39) missense probably damaging 1.00
R4982:Sec24d UTSW 3 123,093,255 (GRCm39) missense probably benign 0.29
R5030:Sec24d UTSW 3 123,152,550 (GRCm39) missense probably damaging 0.98
R5041:Sec24d UTSW 3 123,087,880 (GRCm39) missense probably damaging 0.96
R5078:Sec24d UTSW 3 123,084,201 (GRCm39) missense probably benign 0.00
R5108:Sec24d UTSW 3 123,099,434 (GRCm39) splice site probably null
R5174:Sec24d UTSW 3 123,158,575 (GRCm39) missense probably damaging 0.99
R5661:Sec24d UTSW 3 123,136,791 (GRCm39) missense possibly damaging 0.95
R5661:Sec24d UTSW 3 123,136,734 (GRCm39) missense probably damaging 1.00
R5775:Sec24d UTSW 3 123,084,109 (GRCm39) missense probably benign 0.00
R5859:Sec24d UTSW 3 123,072,961 (GRCm39) unclassified probably benign
R5944:Sec24d UTSW 3 123,087,230 (GRCm39) missense probably benign 0.01
R6053:Sec24d UTSW 3 123,072,871 (GRCm39) nonsense probably null
R6515:Sec24d UTSW 3 123,136,719 (GRCm39) missense possibly damaging 0.92
R6552:Sec24d UTSW 3 123,084,201 (GRCm39) missense probably benign 0.00
R6593:Sec24d UTSW 3 123,147,061 (GRCm39) missense probably damaging 1.00
R6594:Sec24d UTSW 3 123,087,412 (GRCm39) missense probably damaging 1.00
R6842:Sec24d UTSW 3 123,136,868 (GRCm39) missense probably benign 0.00
R7072:Sec24d UTSW 3 123,124,000 (GRCm39) missense probably damaging 1.00
R7481:Sec24d UTSW 3 123,144,412 (GRCm39) missense probably damaging 1.00
R7554:Sec24d UTSW 3 123,149,423 (GRCm39) missense probably damaging 1.00
R8270:Sec24d UTSW 3 123,099,535 (GRCm39) missense possibly damaging 0.90
R8481:Sec24d UTSW 3 123,147,073 (GRCm39) missense probably damaging 1.00
R8713:Sec24d UTSW 3 123,137,541 (GRCm39) missense probably damaging 1.00
R8872:Sec24d UTSW 3 123,148,585 (GRCm39) splice site probably benign
R8922:Sec24d UTSW 3 123,144,488 (GRCm39) missense probably damaging 1.00
R8974:Sec24d UTSW 3 123,099,498 (GRCm39) missense probably damaging 1.00
R9015:Sec24d UTSW 3 123,121,287 (GRCm39) missense probably benign 0.43
R9050:Sec24d UTSW 3 123,144,374 (GRCm39) missense probably benign 0.00
R9065:Sec24d UTSW 3 123,149,452 (GRCm39) missense probably damaging 1.00
R9128:Sec24d UTSW 3 123,087,810 (GRCm39) missense probably benign
R9447:Sec24d UTSW 3 123,084,162 (GRCm39) missense probably benign 0.00
R9701:Sec24d UTSW 3 123,063,321 (GRCm39) missense probably damaging 1.00
R9758:Sec24d UTSW 3 123,136,803 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGCCTCATCTCGCTGGTAG -3'
(R):5'- TTCAAACACACATCTGATCTGCATC -3'

Sequencing Primer
(F):5'- GCCTCATCTCGCTGGTAGAAAAATG -3'
(R):5'- TCTGATCTGCATCACACTGAAAG -3'
Posted On 2018-06-06