Incidental Mutation 'R6526:Cd63'
ID521892
Institutional Source Beutler Lab
Gene Symbol Cd63
Ensembl Gene ENSMUSG00000025351
Gene NameCD63 antigen
SynonymsME491, Tspan30
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6526 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location128900989-128912822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128911489 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 35 (V35A)
Ref Sequence ENSEMBL: ENSMUSP00000151313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026406] [ENSMUST00000026407] [ENSMUST00000105229] [ENSMUST00000137747] [ENSMUST00000149961] [ENSMUST00000219317] [ENSMUST00000220308]
Predicted Effect probably benign
Transcript: ENSMUST00000026406
SMART Domains Protein: ENSMUSP00000026406
Gene: ENSMUSG00000025350

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:adh_short 29 194 3.6e-23 PFAM
Pfam:adh_short_C2 35 230 6.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026407
AA Change: V35A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000026407
Gene: ENSMUSG00000025351
AA Change: V35A

DomainStartEndE-ValueType
Pfam:Tetraspannin 9 231 1.3e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105229
AA Change: V35A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000100862
Gene: ENSMUSG00000025351
AA Change: V35A

DomainStartEndE-ValueType
Pfam:Tetraspannin 9 231 1.3e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137747
SMART Domains Protein: ENSMUSP00000116558
Gene: ENSMUSG00000025350

DomainStartEndE-ValueType
PDB:2JAP|D 1 80 6e-11 PDB
SCOP:d1hu4a_ 1 151 1e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139217
Predicted Effect probably benign
Transcript: ENSMUST00000149961
SMART Domains Protein: ENSMUSP00000123183
Gene: ENSMUSG00000025350

DomainStartEndE-ValueType
Pfam:adh_short 2 124 4e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218450
Predicted Effect probably benign
Transcript: ENSMUST00000219317
AA Change: V35A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220245
Predicted Effect probably benign
Transcript: ENSMUST00000220308
AA Change: V35A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. The encoded protein is a cell surface glycoprotein that is known to complex with integrins. It may function as a blood platelet activation marker. Deficiency of this protein is associated with Hermansky-Pudlak syndrome. Also this gene has been associated with tumor progression. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous null mice are viable and fertile without gross morphological abnormalities, but show an altered water balance, indicated by an increased urinary flow, water intake, reduced urine osmolality, and a higher fecal water content. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,284,172 probably null Het
Abcc3 C T 11: 94,359,372 G975D probably benign Het
Abhd13 G A 8: 9,987,777 G125S probably damaging Het
Ache T A 5: 137,290,644 L204Q probably damaging Het
Acnat2 A G 4: 49,383,497 S19P probably benign Het
Adprh A G 16: 38,447,276 Y216H probably benign Het
Anapc1 T A 2: 128,672,135 K429* probably null Het
Anxa13 T C 15: 58,344,957 noncoding transcript Het
Aprt A C 8: 122,576,816 L6W probably damaging Het
Arhgef15 T C 11: 68,949,994 T569A probably damaging Het
Atp11a T C 8: 12,864,999 L1139P probably benign Het
Atp2b4 A G 1: 133,711,729 S1136P probably damaging Het
B9d1 T A 11: 61,509,097 Y90* probably null Het
Btla G A 16: 45,239,094 A54T probably damaging Het
Chek2 T C 5: 110,848,690 F173L probably damaging Het
Cntnap3 T A 13: 64,781,888 N499I possibly damaging Het
Cog4 T C 8: 110,881,786 L738P probably damaging Het
Cops6 T C 5: 138,163,900 probably null Het
Cpeb1 T A 7: 81,361,669 I175F probably benign Het
Cyp3a16 C T 5: 145,455,895 D174N probably benign Het
Dnah6 T G 6: 73,074,704 I2984L probably benign Het
Dock10 A T 1: 80,586,351 I540N probably damaging Het
Elf5 A G 2: 103,439,233 Y53C probably damaging Het
Elmod2 T C 8: 83,319,457 T164A probably damaging Het
Epn3 A G 11: 94,494,932 probably null Het
Fam151a A T 4: 106,734,004 I15F possibly damaging Het
Gm11115 T A 5: 88,154,050 probably null Het
Gm13103 A G 4: 143,852,814 D323G probably damaging Het
Golga3 T A 5: 110,204,895 I884N probably damaging Het
Gria2 A T 3: 80,692,469 F703I probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gtpbp2 A T 17: 46,164,111 probably null Het
Herc2 T C 7: 56,157,330 S2419P probably damaging Het
Ikbkap T C 4: 56,798,812 probably null Het
Inpp5d T C 1: 87,676,250 probably benign Het
Kdm2b C A 5: 122,961,469 V136F probably damaging Het
Klra2 T A 6: 131,221,876 D234V probably benign Het
Lct A T 1: 128,300,478 S1093T probably benign Het
March9 A G 10: 127,056,689 L310P probably benign Het
Morc1 G T 16: 48,587,124 E668* probably null Het
Mum1 A G 10: 80,232,279 T86A probably benign Het
Nbas A T 12: 13,405,425 L1213F probably damaging Het
Neto1 A G 18: 86,498,748 T397A possibly damaging Het
Oit3 A G 10: 59,429,640 C268R probably damaging Het
Olfr476 A G 7: 107,967,462 T22A probably benign Het
Pcx T C 19: 4,604,495 F312L probably benign Het
Pitx2 T C 3: 129,214,783 probably null Het
Pkhd1l1 G A 15: 44,498,089 probably null Het
Polr1a C A 6: 71,929,443 D414E possibly damaging Het
Prkch T C 12: 73,702,775 Y381H probably damaging Het
Ptger3 T A 3: 157,567,502 V162E probably damaging Het
Ptgr2 T G 12: 84,313,952 M332R probably damaging Het
Ptprq G T 10: 107,542,653 S2009* probably null Het
Rangrf C T 11: 68,973,688 G11R probably damaging Het
Rbl2 A T 8: 91,096,839 Q465L probably benign Het
Rhbdd1 A T 1: 82,340,659 M88L probably benign Het
Setd2 G A 9: 110,532,717 M13I probably benign Het
Sirpb1a T C 3: 15,379,020 Y384C probably damaging Het
Slc13a1 C T 6: 24,097,612 G439S probably damaging Het
Slc41a1 T A 1: 131,841,149 I239N probably damaging Het
Slit2 T A 5: 48,304,167 C1502S probably damaging Het
Slit3 G A 11: 35,661,292 E888K probably benign Het
Srrm3 G T 5: 135,835,234 R62L probably damaging Het
Synm A G 7: 67,735,583 V777A possibly damaging Het
Trmt13 T A 3: 116,592,215 N31I probably damaging Het
Trpm8 G A 1: 88,361,998 E893K probably damaging Het
Uqcc1 A G 2: 155,851,423 F197S probably damaging Het
Vmn1r67 T A 7: 10,447,671 N287K probably benign Het
Vmn2r44 A T 7: 8,378,099 M265K probably benign Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xdh C A 17: 73,900,551 C937F probably damaging Het
Zfp846 T A 9: 20,593,871 N342K probably benign Het
Other mutations in Cd63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02259:Cd63 APN 10 128911974 missense probably benign 0.01
IGL02683:Cd63 APN 10 128910430 missense probably damaging 1.00
R5212:Cd63 UTSW 10 128911853 missense probably damaging 1.00
R5775:Cd63 UTSW 10 128910430 missense probably damaging 0.99
R5888:Cd63 UTSW 10 128912291 splice site probably null
R6180:Cd63 UTSW 10 128912064 critical splice donor site probably null
R7300:Cd63 UTSW 10 128912165 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGTGCCTTAAACAACTTCCC -3'
(R):5'- ACAGAAAAGGCTTCCGGTAGC -3'

Sequencing Primer
(F):5'- CAGCCTTCATTGTGGGGCAAG -3'
(R):5'- TTCCGGTAGCCCCCAAGAG -3'
Posted On2018-06-06