Incidental Mutation 'R6557:Map10'
ID 521903
Institutional Source Beutler Lab
Gene Symbol Map10
Ensembl Gene ENSMUSG00000050930
Gene Name microtubule-associated protein 10
Synonyms 4933403G14Rik
MMRRC Submission 044681-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R6557 (G1)
Quality Score 213.009
Status Not validated
Chromosome 8
Chromosomal Location 126396557-126400098 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 126396991 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 128 (V128A)
Ref Sequence ENSEMBL: ENSMUSP00000061679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053078]
AlphaFold Q8BJS7
Predicted Effect probably damaging
Transcript: ENSMUST00000053078
AA Change: V128A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000061679
Gene: ENSMUSG00000050930
AA Change: V128A

DomainStartEndE-ValueType
low complexity region 38 54 N/A INTRINSIC
low complexity region 68 91 N/A INTRINSIC
Pfam:HPHLAWLY 243 535 1.4e-130 PFAM
Pfam:HPHLAWLY 527 890 9.1e-133 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccn3 A T 15: 54,611,323 (GRCm39) R153* probably null Het
Cxcl15 C T 5: 90,942,425 (GRCm39) probably benign Het
Dysf A G 6: 84,163,366 (GRCm39) D1580G probably damaging Het
Gpc5 A T 14: 115,329,966 (GRCm39) probably benign Het
Greb1 T C 12: 16,760,384 (GRCm39) I575V probably benign Het
Hecw1 T C 13: 14,491,231 (GRCm39) E174G possibly damaging Het
Hip1 T C 5: 135,457,573 (GRCm39) D300G possibly damaging Het
Ica1l T C 1: 60,036,784 (GRCm39) T336A probably benign Het
Ikzf3 C T 11: 98,407,707 (GRCm39) A45T probably benign Het
Krtap16-1 T C 11: 99,875,956 (GRCm39) S483G possibly damaging Het
Lamb2 T C 9: 108,365,599 (GRCm39) L1394P probably damaging Het
Liph T A 16: 21,802,670 (GRCm39) E133V possibly damaging Het
Mamdc2 A G 19: 23,288,209 (GRCm39) S610P possibly damaging Het
Mon2 C A 10: 122,852,307 (GRCm39) C1022F probably damaging Het
Nfatc3 T C 8: 106,845,986 (GRCm39) S1039P probably benign Het
Or4f52 T C 2: 111,061,976 (GRCm39) H54R probably benign Het
Scaper T C 9: 55,458,134 (GRCm39) N879S probably benign Het
Sec24d T C 3: 123,136,736 (GRCm39) Y490H probably damaging Het
Tdrd5 T C 1: 156,128,291 (GRCm39) K137R probably benign Het
Topaz1 A G 9: 122,577,960 (GRCm39) N290S probably benign Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Zfp638 C A 6: 83,907,092 (GRCm39) P419Q probably damaging Het
Zzz3 T A 3: 152,134,097 (GRCm39) L385Q probably damaging Het
Other mutations in Map10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Map10 APN 8 126,398,671 (GRCm39) missense probably benign 0.00
IGL01567:Map10 APN 8 126,398,232 (GRCm39) missense probably benign 0.32
IGL02566:Map10 APN 8 126,398,494 (GRCm39) missense probably benign
IGL03088:Map10 APN 8 126,397,809 (GRCm39) missense probably benign 0.14
debauched UTSW 8 126,397,984 (GRCm39) missense probably damaging 1.00
R1083:Map10 UTSW 8 126,397,178 (GRCm39) nonsense probably null
R1543:Map10 UTSW 8 126,397,611 (GRCm39) missense probably benign 0.00
R3155:Map10 UTSW 8 126,398,313 (GRCm39) missense possibly damaging 0.79
R4076:Map10 UTSW 8 126,398,584 (GRCm39) missense probably benign 0.23
R4559:Map10 UTSW 8 126,398,553 (GRCm39) missense probably benign
R4856:Map10 UTSW 8 126,397,431 (GRCm39) missense probably damaging 1.00
R4886:Map10 UTSW 8 126,397,431 (GRCm39) missense probably damaging 1.00
R5412:Map10 UTSW 8 126,397,724 (GRCm39) missense probably damaging 1.00
R6034:Map10 UTSW 8 126,399,205 (GRCm39) missense probably damaging 1.00
R6034:Map10 UTSW 8 126,399,205 (GRCm39) missense probably damaging 1.00
R6150:Map10 UTSW 8 126,398,328 (GRCm39) missense probably damaging 0.96
R6351:Map10 UTSW 8 126,397,984 (GRCm39) missense probably damaging 1.00
R6466:Map10 UTSW 8 126,399,123 (GRCm39) nonsense probably null
R6544:Map10 UTSW 8 126,398,113 (GRCm39) missense probably benign 0.00
R6821:Map10 UTSW 8 126,397,138 (GRCm39) missense probably benign 0.01
R7096:Map10 UTSW 8 126,398,662 (GRCm39) missense probably damaging 0.99
R7128:Map10 UTSW 8 126,398,592 (GRCm39) missense probably benign
R7177:Map10 UTSW 8 126,398,584 (GRCm39) missense probably benign 0.23
R7237:Map10 UTSW 8 126,397,963 (GRCm39) missense probably benign 0.03
R7814:Map10 UTSW 8 126,398,350 (GRCm39) missense probably benign 0.14
R7819:Map10 UTSW 8 126,397,260 (GRCm39) frame shift probably null
R8202:Map10 UTSW 8 126,397,647 (GRCm39) missense possibly damaging 0.95
R8812:Map10 UTSW 8 126,396,664 (GRCm39) missense probably damaging 0.99
R8859:Map10 UTSW 8 126,397,291 (GRCm39) missense probably benign 0.04
R8947:Map10 UTSW 8 126,397,839 (GRCm39) missense probably benign 0.06
R9178:Map10 UTSW 8 126,397,649 (GRCm39) missense probably damaging 0.98
R9698:Map10 UTSW 8 126,398,723 (GRCm39) missense probably benign 0.16
Z1088:Map10 UTSW 8 126,398,670 (GRCm39) frame shift probably null
Z1177:Map10 UTSW 8 126,396,809 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCAAGTCTCGCGAGGG -3'
(R):5'- CAGAGATGCCTTTGGTGCATG -3'

Sequencing Primer
(F):5'- GCTCTTCTCGCTGGAGCTG -3'
(R):5'- TGCATGGCTTCGAGGTCTCC -3'
Posted On 2018-06-06