Incidental Mutation 'R6557:Map10'
ID521903
Institutional Source Beutler Lab
Gene Symbol Map10
Ensembl Gene ENSMUSG00000050930
Gene Namemicrotubule-associated protein 10
Synonyms4933403G14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R6557 (G1)
Quality Score213.009
Status Not validated
Chromosome8
Chromosomal Location125669818-125673359 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125670252 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 128 (V128A)
Ref Sequence ENSEMBL: ENSMUSP00000061679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053078]
Predicted Effect probably damaging
Transcript: ENSMUST00000053078
AA Change: V128A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000061679
Gene: ENSMUSG00000050930
AA Change: V128A

DomainStartEndE-ValueType
low complexity region 38 54 N/A INTRINSIC
low complexity region 68 91 N/A INTRINSIC
Pfam:HPHLAWLY 243 535 1.4e-130 PFAM
Pfam:HPHLAWLY 527 890 9.1e-133 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cxcl15 C T 5: 90,794,566 probably benign Het
Dysf A G 6: 84,186,384 D1580G probably damaging Het
Gpc5 A T 14: 115,092,534 probably benign Het
Greb1 T C 12: 16,710,383 I575V probably benign Het
Hecw1 T C 13: 14,316,646 E174G possibly damaging Het
Hip1 T C 5: 135,428,719 D300G possibly damaging Het
Ica1l T C 1: 59,997,625 T336A probably benign Het
Ikzf3 C T 11: 98,516,881 A45T probably benign Het
Krtap16-1 T C 11: 99,985,130 S483G possibly damaging Het
Lamb2 T C 9: 108,488,400 L1394P probably damaging Het
Liph T A 16: 21,983,920 E133V possibly damaging Het
Mamdc2 A G 19: 23,310,845 S610P possibly damaging Het
Mon2 C A 10: 123,016,402 C1022F probably damaging Het
Nfatc3 T C 8: 106,119,354 S1039P probably benign Het
Nov A T 15: 54,747,927 R153* probably null Het
Olfr1275 T C 2: 111,231,631 H54R probably benign Het
Scaper T C 9: 55,550,850 N879S probably benign Het
Sec24d T C 3: 123,343,087 Y490H probably damaging Het
Tdrd5 T C 1: 156,300,721 K137R probably benign Het
Topaz1 A G 9: 122,748,895 N290S probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfp638 C A 6: 83,930,110 P419Q probably damaging Het
Zzz3 T A 3: 152,428,460 L385Q probably damaging Het
Other mutations in Map10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Map10 APN 8 125671932 missense probably benign 0.00
IGL01567:Map10 APN 8 125671493 missense probably benign 0.32
IGL02566:Map10 APN 8 125671755 missense probably benign
IGL03088:Map10 APN 8 125671070 missense probably benign 0.14
debauched UTSW 8 125671245 missense probably damaging 1.00
R1083:Map10 UTSW 8 125670439 nonsense probably null
R1543:Map10 UTSW 8 125670872 missense probably benign 0.00
R3155:Map10 UTSW 8 125671574 missense possibly damaging 0.79
R4076:Map10 UTSW 8 125671845 missense probably benign 0.23
R4559:Map10 UTSW 8 125671814 missense probably benign
R4856:Map10 UTSW 8 125670692 missense probably damaging 1.00
R4886:Map10 UTSW 8 125670692 missense probably damaging 1.00
R5412:Map10 UTSW 8 125670985 missense probably damaging 1.00
R6034:Map10 UTSW 8 125672466 missense probably damaging 1.00
R6034:Map10 UTSW 8 125672466 missense probably damaging 1.00
R6150:Map10 UTSW 8 125671589 missense probably damaging 0.96
R6351:Map10 UTSW 8 125671245 missense probably damaging 1.00
R6466:Map10 UTSW 8 125672384 nonsense probably null
R6544:Map10 UTSW 8 125671374 missense probably benign 0.00
R6821:Map10 UTSW 8 125670399 missense probably benign 0.01
R7096:Map10 UTSW 8 125671923 missense probably damaging 0.99
R7128:Map10 UTSW 8 125671853 missense probably benign
R7177:Map10 UTSW 8 125671845 missense probably benign 0.23
R7237:Map10 UTSW 8 125671224 missense probably benign 0.03
R7814:Map10 UTSW 8 125671611 missense probably benign 0.14
R7819:Map10 UTSW 8 125670521 frame shift probably null
R8202:Map10 UTSW 8 125670908 missense possibly damaging 0.95
Z1088:Map10 UTSW 8 125671931 frame shift probably null
Z1177:Map10 UTSW 8 125670070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCAAGTCTCGCGAGGG -3'
(R):5'- CAGAGATGCCTTTGGTGCATG -3'

Sequencing Primer
(F):5'- GCTCTTCTCGCTGGAGCTG -3'
(R):5'- TGCATGGCTTCGAGGTCTCC -3'
Posted On2018-06-06