Incidental Mutation 'R6526:Nbas'
ID 521906
Institutional Source Beutler Lab
Gene Symbol Nbas
Ensembl Gene ENSMUSG00000020576
Gene Name neuroblastoma amplified sequence
Synonyms 4933425L03Rik
MMRRC Submission
Accession Numbers

Genbank: NM_027706.1; Ensembl: ENSMUST00000042953
Essential gene? Essential (E-score: 1.000) question?
Stock # R6526 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 13269133-13583811 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 13405425 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 1213 (L1213F)
Ref Sequence ENSEMBL: ENSMUSP00000036082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042953]
AlphaFold E9Q411
Predicted Effect probably damaging
Transcript: ENSMUST00000042953
AA Change: L1213F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036082
Gene: ENSMUSG00000020576
AA Change: L1213F

DomainStartEndE-ValueType
Pfam:Nbas_N 89 370 4.7e-171 PFAM
low complexity region 463 475 N/A INTRINSIC
low complexity region 653 667 N/A INTRINSIC
Pfam:Sec39 725 1375 3.8e-34 PFAM
low complexity region 1392 1404 N/A INTRINSIC
low complexity region 1549 1566 N/A INTRINSIC
low complexity region 2226 2252 N/A INTRINSIC
low complexity region 2275 2285 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two leucine zipper domains, a ribosomal protein S14 signature domain and a Sec39 like domain. The protein is thought to be involved in Golgi-to-ER transport. Mutations in this gene are associated with short stature, optic nerve atrophy, and Pelger-Huet anomaly. [provided by RefSeq, Oct 2012]
Allele List at MGI

All alleles(10) : Targeted, other(2) Gene trapped(8)
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,284,172 probably null Het
Abcc3 C T 11: 94,359,372 G975D probably benign Het
Abhd13 G A 8: 9,987,777 G125S probably damaging Het
Ache T A 5: 137,290,644 L204Q probably damaging Het
Acnat2 A G 4: 49,383,497 S19P probably benign Het
Adprh A G 16: 38,447,276 Y216H probably benign Het
Anapc1 T A 2: 128,672,135 K429* probably null Het
Anxa13 T C 15: 58,344,957 noncoding transcript Het
Aprt A C 8: 122,576,816 L6W probably damaging Het
Arhgef15 T C 11: 68,949,994 T569A probably damaging Het
Atp11a T C 8: 12,864,999 L1139P probably benign Het
Atp2b4 A G 1: 133,711,729 S1136P probably damaging Het
B9d1 T A 11: 61,509,097 Y90* probably null Het
Btla G A 16: 45,239,094 A54T probably damaging Het
Cd63 T C 10: 128,911,489 V35A probably benign Het
Chek2 T C 5: 110,848,690 F173L probably damaging Het
Cntnap3 T A 13: 64,781,888 N499I possibly damaging Het
Cog4 T C 8: 110,881,786 L738P probably damaging Het
Cops6 T C 5: 138,163,900 probably null Het
Cpeb1 T A 7: 81,361,669 I175F probably benign Het
Cyp3a16 C T 5: 145,455,895 D174N probably benign Het
Dnah6 T G 6: 73,074,704 I2984L probably benign Het
Dock10 A T 1: 80,586,351 I540N probably damaging Het
Elf5 A G 2: 103,439,233 Y53C probably damaging Het
Elmod2 T C 8: 83,319,457 T164A probably damaging Het
Epn3 A G 11: 94,494,932 probably null Het
Fam151a A T 4: 106,734,004 I15F possibly damaging Het
Gm11115 T A 5: 88,154,050 probably null Het
Gm13103 A G 4: 143,852,814 D323G probably damaging Het
Golga3 T A 5: 110,204,895 I884N probably damaging Het
Gria2 A T 3: 80,692,469 F703I probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gtpbp2 A T 17: 46,164,111 probably null Het
Herc2 T C 7: 56,157,330 S2419P probably damaging Het
Ikbkap T C 4: 56,798,812 probably null Het
Inpp5d T C 1: 87,676,250 probably benign Het
Kdm2b C A 5: 122,961,469 V136F probably damaging Het
Klra2 T A 6: 131,221,876 D234V probably benign Het
Lct A T 1: 128,300,478 S1093T probably benign Het
March9 A G 10: 127,056,689 L310P probably benign Het
Morc1 G T 16: 48,587,124 E668* probably null Het
Mum1 A G 10: 80,232,279 T86A probably benign Het
Neto1 A G 18: 86,498,748 T397A possibly damaging Het
Oit3 A G 10: 59,429,640 C268R probably damaging Het
Olfr476 A G 7: 107,967,462 T22A probably benign Het
Pcx T C 19: 4,604,495 F312L probably benign Het
Pitx2 T C 3: 129,214,783 probably null Het
Pkhd1l1 G A 15: 44,498,089 probably null Het
Polr1a C A 6: 71,929,443 D414E possibly damaging Het
Prkch T C 12: 73,702,775 Y381H probably damaging Het
Ptger3 T A 3: 157,567,502 V162E probably damaging Het
Ptgr2 T G 12: 84,313,952 M332R probably damaging Het
Ptprq G T 10: 107,542,653 S2009* probably null Het
Rangrf C T 11: 68,973,688 G11R probably damaging Het
Rbl2 A T 8: 91,096,839 Q465L probably benign Het
Rhbdd1 A T 1: 82,340,659 M88L probably benign Het
Setd2 G A 9: 110,532,717 M13I probably benign Het
Sirpb1a T C 3: 15,379,020 Y384C probably damaging Het
Slc13a1 C T 6: 24,097,612 G439S probably damaging Het
Slc41a1 T A 1: 131,841,149 I239N probably damaging Het
Slit2 T A 5: 48,304,167 C1502S probably damaging Het
Slit3 G A 11: 35,661,292 E888K probably benign Het
Srrm3 G T 5: 135,835,234 R62L probably damaging Het
Synm A G 7: 67,735,583 V777A possibly damaging Het
Trmt13 T A 3: 116,592,215 N31I probably damaging Het
Trpm8 G A 1: 88,361,998 E893K probably damaging Het
Uqcc1 A G 2: 155,851,423 F197S probably damaging Het
Vmn1r67 T A 7: 10,447,671 N287K probably benign Het
Vmn2r44 A T 7: 8,378,099 M265K probably benign Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xdh C A 17: 73,900,551 C937F probably damaging Het
Zfp846 T A 9: 20,593,871 N342K probably benign Het
Other mutations in Nbas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Nbas APN 12 13453075 missense probably benign 0.19
IGL00712:Nbas APN 12 13362625 splice site probably benign
IGL00808:Nbas APN 12 13566120 splice site probably benign
IGL00915:Nbas APN 12 13374752 nonsense probably null
IGL00923:Nbas APN 12 13336284 missense possibly damaging 0.46
IGL01152:Nbas APN 12 13360958 missense probably damaging 1.00
IGL01633:Nbas APN 12 13483897 missense probably damaging 1.00
IGL01672:Nbas APN 12 13379649 missense possibly damaging 0.63
IGL01799:Nbas APN 12 13324400 splice site probably benign
IGL01812:Nbas APN 12 13453503 missense probably damaging 1.00
IGL01934:Nbas APN 12 13289879 splice site probably benign
IGL02093:Nbas APN 12 13560962 missense probably benign 0.00
IGL02115:Nbas APN 12 13317692 splice site probably benign
IGL02175:Nbas APN 12 13566259 critical splice donor site probably null
IGL02268:Nbas APN 12 13405397 missense possibly damaging 0.94
IGL02483:Nbas APN 12 13324294 missense probably damaging 1.00
IGL02539:Nbas APN 12 13272703 splice site probably benign
IGL02557:Nbas APN 12 13361028 missense probably damaging 1.00
IGL02815:Nbas APN 12 13310266 missense probably damaging 1.00
IGL02951:Nbas APN 12 13362541 missense probably benign
IGL03131:Nbas APN 12 13279416 missense probably benign 0.03
IGL03214:Nbas APN 12 13331110 splice site probably benign
IGL03308:Nbas APN 12 13324348 missense possibly damaging 0.93
IGL03368:Nbas APN 12 13328451 missense probably benign 0.08
IGL03372:Nbas APN 12 13534472 missense probably damaging 1.00
IGL03391:Nbas APN 12 13483749 missense probably benign 0.28
medvedev UTSW 12 13534577 critical splice donor site probably null
oligarchs UTSW 12 13520750 missense possibly damaging 0.75
putin UTSW 12 13321755 missense probably damaging 1.00
1mM(1):Nbas UTSW 12 13288728 missense probably damaging 1.00
R0057:Nbas UTSW 12 13390957 missense probably benign 0.00
R0076:Nbas UTSW 12 13324336 missense probably damaging 1.00
R0153:Nbas UTSW 12 13273876 splice site probably benign
R0371:Nbas UTSW 12 13331095 missense probably damaging 0.97
R0449:Nbas UTSW 12 13519108 missense probably benign 0.18
R0791:Nbas UTSW 12 13482633 missense probably benign 0.28
R0931:Nbas UTSW 12 13331114 splice site probably benign
R1236:Nbas UTSW 12 13269241 missense probably damaging 1.00
R1371:Nbas UTSW 12 13482378 splice site probably benign
R1567:Nbas UTSW 12 13285278 missense possibly damaging 0.70
R1587:Nbas UTSW 12 13558685 missense probably benign
R1719:Nbas UTSW 12 13560977 critical splice donor site probably null
R1747:Nbas UTSW 12 13335898 missense probably benign 0.00
R1777:Nbas UTSW 12 13513562 missense probably benign 0.16
R1848:Nbas UTSW 12 13413597 missense probably damaging 0.97
R1856:Nbas UTSW 12 13474229 missense possibly damaging 0.56
R1891:Nbas UTSW 12 13390972 missense possibly damaging 0.92
R1911:Nbas UTSW 12 13566144 missense probably benign
R1912:Nbas UTSW 12 13566144 missense probably benign
R2006:Nbas UTSW 12 13414741 splice site probably null
R2054:Nbas UTSW 12 13474206 missense probably benign 0.36
R2065:Nbas UTSW 12 13566157 missense probably damaging 1.00
R2089:Nbas UTSW 12 13361045 missense probably benign 0.03
R2091:Nbas UTSW 12 13361045 missense probably benign 0.03
R2091:Nbas UTSW 12 13361045 missense probably benign 0.03
R2156:Nbas UTSW 12 13441509 missense probably damaging 1.00
R2164:Nbas UTSW 12 13330646 missense possibly damaging 0.74
R2339:Nbas UTSW 12 13362592 missense probably benign 0.12
R2398:Nbas UTSW 12 13432945 missense probably damaging 0.99
R3806:Nbas UTSW 12 13482504 missense probably damaging 1.00
R3855:Nbas UTSW 12 13279414 missense possibly damaging 0.50
R4019:Nbas UTSW 12 13482519 missense probably damaging 1.00
R4083:Nbas UTSW 12 13474191 missense probably damaging 0.96
R4201:Nbas UTSW 12 13374826 missense probably benign 0.00
R4231:Nbas UTSW 12 13393343 missense probably damaging 0.98
R4552:Nbas UTSW 12 13335937 critical splice donor site probably null
R4560:Nbas UTSW 12 13583527 missense probably benign 0.00
R4728:Nbas UTSW 12 13288739 missense probably damaging 0.98
R4752:Nbas UTSW 12 13482537 missense possibly damaging 0.92
R4832:Nbas UTSW 12 13483739 missense probably benign 0.00
R4874:Nbas UTSW 12 13321755 missense probably damaging 1.00
R4988:Nbas UTSW 12 13408265 missense probably benign 0.45
R5020:Nbas UTSW 12 13374712 missense probably damaging 0.99
R5079:Nbas UTSW 12 13374711 missense probably damaging 1.00
R5129:Nbas UTSW 12 13390960 missense probably damaging 1.00
R5239:Nbas UTSW 12 13441518 missense probably benign 0.31
R5299:Nbas UTSW 12 13441925 nonsense probably null
R5351:Nbas UTSW 12 13560849 missense probably damaging 1.00
R5389:Nbas UTSW 12 13534577 critical splice donor site probably null
R5436:Nbas UTSW 12 13374811 missense probably damaging 1.00
R5654:Nbas UTSW 12 13583475 missense probably damaging 1.00
R5690:Nbas UTSW 12 13336284 missense probably damaging 1.00
R5842:Nbas UTSW 12 13269266 critical splice donor site probably null
R5959:Nbas UTSW 12 13288801 missense probably damaging 0.99
R5982:Nbas UTSW 12 13393430 missense probably benign 0.00
R6238:Nbas UTSW 12 13482595 missense probably benign
R6270:Nbas UTSW 12 13324293 missense probably damaging 1.00
R6363:Nbas UTSW 12 13482576 missense probably benign
R6424:Nbas UTSW 12 13415733 critical splice donor site probably null
R6458:Nbas UTSW 12 13288749 missense probably damaging 1.00
R6654:Nbas UTSW 12 13483874 nonsense probably null
R7085:Nbas UTSW 12 13285258 missense probably damaging 1.00
R7179:Nbas UTSW 12 13405397 missense possibly damaging 0.94
R7197:Nbas UTSW 12 13520750 missense possibly damaging 0.75
R7378:Nbas UTSW 12 13274219 missense probably damaging 1.00
R7393:Nbas UTSW 12 13393492 missense probably damaging 1.00
R7425:Nbas UTSW 12 13469880 missense probably damaging 1.00
R7446:Nbas UTSW 12 13393498 missense probably benign 0.02
R7481:Nbas UTSW 12 13356959 missense probably damaging 0.97
R7535:Nbas UTSW 12 13279389 missense probably damaging 0.97
R7626:Nbas UTSW 12 13558660 missense probably benign 0.00
R7678:Nbas UTSW 12 13415661 missense probably damaging 0.97
R7912:Nbas UTSW 12 13405457 missense possibly damaging 0.91
R7964:Nbas UTSW 12 13356895 missense probably damaging 0.99
R8193:Nbas UTSW 12 13433009 missense probably damaging 1.00
R8325:Nbas UTSW 12 13288795 missense probably damaging 1.00
R8405:Nbas UTSW 12 13279393 missense probably damaging 1.00
R8437:Nbas UTSW 12 13566250 missense possibly damaging 0.46
R8559:Nbas UTSW 12 13352808 missense probably benign 0.00
R8684:Nbas UTSW 12 13336367 missense probably damaging 1.00
R8826:Nbas UTSW 12 13352874 splice site probably benign
R8921:Nbas UTSW 12 13413589 missense probably benign
R8956:Nbas UTSW 12 13432922 missense possibly damaging 0.51
R9083:Nbas UTSW 12 13335855 missense possibly damaging 0.56
R9172:Nbas UTSW 12 13374750 missense possibly damaging 0.65
R9430:Nbas UTSW 12 13321653 missense probably benign 0.35
R9627:Nbas UTSW 12 13300202 missense possibly damaging 0.76
R9649:Nbas UTSW 12 13583416 missense probably damaging 1.00
RF013:Nbas UTSW 12 13279408 missense possibly damaging 0.54
T0722:Nbas UTSW 12 13352808 missense probably benign 0.00
Z1176:Nbas UTSW 12 13483876 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CGAGTCATGCTGCATCACAC -3'
(R):5'- AGGAAATTCTCTGAGAATCTGAGG -3'

Sequencing Primer
(F):5'- ATCACACCTGGGACCATTGG -3'
(R):5'- GCAAAGGCAGGGTCTTC -3'
Posted On 2018-06-06