Mutagenetix > Incidental Mutation

Incidental Mutation 'R6557:Lamb2'

521907

Institutional Source

Beutler Lab

Gene Symbol

Lamb2

Ensembl Gene

ENSMUSG00000052911

Gene Name

laminin, beta 2

Synonyms

Lams, npht, Lamb-2

MMRRC Submission

044681-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.854) question?

Stock #

R6557 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

108357080-108367729 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 108365599 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 1394 (L1394P)

Ref Sequence

ENSEMBL: ENSMUSP00000069087 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006854] [ENSMUST00000065014] [ENSMUST00000085044] [ENSMUST00000166103] [ENSMUST00000178075] [ENSMUST00000193678]

AlphaFold

Q61292

Predicted Effect

probably benign
Transcript: ENSMUST00000006854

SMART Domains

Protein: ENSMUSP00000006854
Gene: ENSMUSG00000006676

Domain	Start	End	E-Value	Type
Pfam:CS	55	129	1.3e-6	PFAM
low complexity region	257	268	N/A	INTRINSIC
Pfam:CS	326	414	7.1e-19	PFAM
Pfam:USP19_linker	415	537	2.2e-61	PFAM
Pfam:UCH	538	1253	1.2e-77	PFAM
Pfam:UCH_1	539	874	8.6e-11	PFAM
Pfam:zf-MYND	833	875	9.9e-11	PFAM
Pfam:UCH_1	1021	1235	7.1e-10	PFAM
low complexity region	1278	1287	N/A	INTRINSIC
low complexity region	1301	1312	N/A	INTRINSIC
transmembrane domain	1333	1355	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000065014
AA Change: L1394P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000069087
Gene: ENSMUSG00000052911
AA Change: L1394P

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
LamNT	44	284	1.9e-102	SMART
EGF_Lam	286	347	1.34e-6	SMART
EGF_Lam	350	410	6.1e-10	SMART
EGF_Lam	413	470	2.98e-13	SMART
EGF_Lam	473	522	7.93e-9	SMART
EGF_Lam	525	569	1.01e-10	SMART
EGF_Lam	784	829	3.42e-13	SMART
EGF_Lam	832	875	6.54e-10	SMART
EGF_Lam	878	925	1.34e-6	SMART
EGF_Lam	928	984	4.74e-7	SMART
EGF_Lam	987	1036	1.53e-10	SMART
EGF_Lam	1039	1093	6.29e-12	SMART
EGF_Lam	1096	1141	1.79e-7	SMART
EGF_Lam	1144	1188	6.64e-11	SMART
coiled coil region	1261	1299	N/A	INTRINSIC
low complexity region	1445	1458	N/A	INTRINSIC
coiled coil region	1473	1527	N/A	INTRINSIC
low complexity region	1609	1625	N/A	INTRINSIC
SCOP:d1eq1a_	1632	1786	5e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000085044

SMART Domains

Protein: ENSMUSP00000082119
Gene: ENSMUSG00000006676

Domain	Start	End	E-Value	Type
Pfam:CS	55	129	4.7e-7	PFAM
low complexity region	257	268	N/A	INTRINSIC
Pfam:CS	326	414	2.5e-15	PFAM
low complexity region	449	460	N/A	INTRINSIC
low complexity region	524	530	N/A	INTRINSIC
Pfam:UCH	538	1253	7.4e-84	PFAM
Pfam:UCH_1	539	879	2.3e-13	PFAM
Pfam:zf-MYND	833	875	2.4e-10	PFAM
Pfam:UCH_1	1020	1235	2.9e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000166103

SMART Domains

Protein: ENSMUSP00000128573
Gene: ENSMUSG00000006676

Domain	Start	End	E-Value	Type
Pfam:CS	55	129	2.6e-7	PFAM
low complexity region	257	268	N/A	INTRINSIC
Pfam:CS	326	390	3.9e-9	PFAM
low complexity region	425	436	N/A	INTRINSIC
low complexity region	500	506	N/A	INTRINSIC
Pfam:UCH	514	1229	1.8e-84	PFAM
Pfam:UCH_1	515	855	5.5e-14	PFAM
Pfam:zf-MYND	809	851	1.7e-10	PFAM
Pfam:UCH_1	996	1211	6.9e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000178075

SMART Domains

Protein: ENSMUSP00000135930
Gene: ENSMUSG00000006676

Domain	Start	End	E-Value	Type
Pfam:CS	55	129	1e-6	PFAM
low complexity region	258	269	N/A	INTRINSIC
Pfam:CS	327	415	5.4e-15	PFAM
low complexity region	450	461	N/A	INTRINSIC
low complexity region	525	531	N/A	INTRINSIC
Pfam:UCH	539	1254	4.9e-84	PFAM
Pfam:UCH_1	540	880	1.4e-13	PFAM
Pfam:zf-MYND	834	876	5.2e-10	PFAM
Pfam:UCH_1	1021	1236	1.8e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192854

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193301

Predicted Effect

probably benign
Transcript: ENSMUST00000193678

SMART Domains

Protein: ENSMUSP00000141738
Gene: ENSMUSG00000006676

Domain	Start	End	E-Value	Type
Pfam:CS	55	129	6.8e-7	PFAM
low complexity region	258	269	N/A	INTRINSIC
Pfam:CS	327	415	3.6e-15	PFAM
low complexity region	448	459	N/A	INTRINSIC
low complexity region	523	529	N/A	INTRINSIC
Pfam:UCH	537	1252	3.8e-84	PFAM
Pfam:UCH_1	538	878	1.1e-13	PFAM
Pfam:zf-MYND	832	874	5.1e-10	PFAM
Pfam:UCH_1	1019	1234	1.4e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194421

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the beta chain isoform laminin, beta 2. The beta 2 chain contains the 7 structural domains typical of beta chains of laminin, including the short alpha region. However, unlike beta 1 chain, beta 2 has a more restricted tissue distribution. It is enriched in the basement membrane of muscles at the neuromuscular junctions, kidney glomerulus and vascular smooth muscle. Transgenic mice in which the beta 2 chain gene was inactivated by homologous recombination, showed defects in the maturation of neuromuscular junctions and impairment of glomerular filtration. Alternative splicing involving a non consensus 5' splice site (gc) in the 5' UTR of this gene has been reported. It was suggested that inefficient splicing of this first intron, which does not change the protein sequence, results in a greater abundance of the unspliced form of the transcript than the spliced form. The full-length nature of the spliced transcript is not known. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit small size, severe proteinuria due to a defect in glomerular filtration, abnormalities of the retina and skeletal neuromuscular synapses, and lethality by 30 days of age. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted, knock-out(2) Gene trapped(3)

Other mutations in this stock

Total: 23 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ccn3	A	T	15: 54,611,323 (GRCm39)	R153*	probably null	Het
Cxcl15	C	T	5: 90,942,425 (GRCm39)		probably benign	Het
Dysf	A	G	6: 84,163,366 (GRCm39)	D1580G	probably damaging	Het
Gpc5	A	T	14: 115,329,966 (GRCm39)		probably benign	Het
Greb1	T	C	12: 16,760,384 (GRCm39)	I575V	probably benign	Het
Hecw1	T	C	13: 14,491,231 (GRCm39)	E174G	possibly damaging	Het
Hip1	T	C	5: 135,457,573 (GRCm39)	D300G	possibly damaging	Het
Ica1l	T	C	1: 60,036,784 (GRCm39)	T336A	probably benign	Het
Ikzf3	C	T	11: 98,407,707 (GRCm39)	A45T	probably benign	Het
Krtap16-1	T	C	11: 99,875,956 (GRCm39)	S483G	possibly damaging	Het
Liph	T	A	16: 21,802,670 (GRCm39)	E133V	possibly damaging	Het
Mamdc2	A	G	19: 23,288,209 (GRCm39)	S610P	possibly damaging	Het
Map10	T	C	8: 126,396,991 (GRCm39)	V128A	probably damaging	Het
Mon2	C	A	10: 122,852,307 (GRCm39)	C1022F	probably damaging	Het
Nfatc3	T	C	8: 106,845,986 (GRCm39)	S1039P	probably benign	Het
Or4f52	T	C	2: 111,061,976 (GRCm39)	H54R	probably benign	Het
Scaper	T	C	9: 55,458,134 (GRCm39)	N879S	probably benign	Het
Sec24d	T	C	3: 123,136,736 (GRCm39)	Y490H	probably damaging	Het
Tdrd5	T	C	1: 156,128,291 (GRCm39)	K137R	probably benign	Het
Topaz1	A	G	9: 122,577,960 (GRCm39)	N290S	probably benign	Het
Vmn2r111	T	C	17: 22,778,032 (GRCm39)	N549S	possibly damaging	Het
Zfp638	C	A	6: 83,907,092 (GRCm39)	P419Q	probably damaging	Het
Zzz3	T	A	3: 152,134,097 (GRCm39)	L385Q	probably damaging	Het

Other mutations in Lamb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01370:Lamb2	APN	9	108,364,932 (GRCm39)	splice site	probably null
IGL02072:Lamb2	APN	9	108,359,107 (GRCm39)	nonsense	probably null
IGL02079:Lamb2	APN	9	108,359,312 (GRCm39)	missense	probably damaging	1.00
IGL02087:Lamb2	APN	9	108,364,318 (GRCm39)	missense	possibly damaging	0.95
IGL02193:Lamb2	APN	9	108,366,559 (GRCm39)	missense	probably benign	0.00
IGL02199:Lamb2	APN	9	108,357,824 (GRCm39)	missense	possibly damaging	0.49
IGL02201:Lamb2	APN	9	108,364,741 (GRCm39)	missense	probably damaging	1.00
IGL02468:Lamb2	APN	9	108,364,348 (GRCm39)	missense	probably damaging	1.00
F6893:Lamb2	UTSW	9	108,359,755 (GRCm39)	missense	probably benign	0.12
R0053:Lamb2	UTSW	9	108,363,936 (GRCm39)	nonsense	probably null
R0053:Lamb2	UTSW	9	108,363,936 (GRCm39)	nonsense	probably null
R0122:Lamb2	UTSW	9	108,363,713 (GRCm39)	missense	probably benign	0.01
R0452:Lamb2	UTSW	9	108,363,553 (GRCm39)	unclassified	probably benign
R0524:Lamb2	UTSW	9	108,361,571 (GRCm39)	missense	possibly damaging	0.90
R0605:Lamb2	UTSW	9	108,363,304 (GRCm39)	unclassified	probably benign
R0737:Lamb2	UTSW	9	108,360,993 (GRCm39)	missense	probably benign	0.03
R1083:Lamb2	UTSW	9	108,360,892 (GRCm39)	missense	probably benign
R1159:Lamb2	UTSW	9	108,358,607 (GRCm39)	missense	probably damaging	1.00
R1283:Lamb2	UTSW	9	108,359,007 (GRCm39)	missense	possibly damaging	0.46
R1507:Lamb2	UTSW	9	108,367,581 (GRCm39)	missense	probably damaging	1.00
R1547:Lamb2	UTSW	9	108,359,824 (GRCm39)	missense	probably benign	0.00
R1576:Lamb2	UTSW	9	108,357,506 (GRCm39)	missense	probably damaging	0.96
R1647:Lamb2	UTSW	9	108,358,622 (GRCm39)	critical splice donor site	probably null
R1678:Lamb2	UTSW	9	108,360,885 (GRCm39)	critical splice acceptor site	probably null
R1740:Lamb2	UTSW	9	108,359,127 (GRCm39)	missense	probably damaging	1.00
R1803:Lamb2	UTSW	9	108,365,298 (GRCm39)	missense	probably benign
R1846:Lamb2	UTSW	9	108,364,586 (GRCm39)	missense	probably benign	0.00
R1863:Lamb2	UTSW	9	108,358,583 (GRCm39)	missense	probably benign	0.13
R2184:Lamb2	UTSW	9	108,357,752 (GRCm39)	missense	probably damaging	1.00
R2262:Lamb2	UTSW	9	108,357,809 (GRCm39)	missense	probably damaging	1.00
R2338:Lamb2	UTSW	9	108,359,340 (GRCm39)	missense	probably benign	0.20
R2483:Lamb2	UTSW	9	108,357,758 (GRCm39)	missense	probably damaging	1.00
R4084:Lamb2	UTSW	9	108,365,217 (GRCm39)	missense	probably benign	0.17
R4164:Lamb2	UTSW	9	108,367,497 (GRCm39)	missense	probably damaging	1.00
R4295:Lamb2	UTSW	9	108,363,410 (GRCm39)	missense	probably benign	0.42
R4422:Lamb2	UTSW	9	108,360,754 (GRCm39)	missense	probably damaging	0.99
R4497:Lamb2	UTSW	9	108,363,997 (GRCm39)	missense	probably damaging	1.00
R4880:Lamb2	UTSW	9	108,361,226 (GRCm39)	splice site	probably null
R4935:Lamb2	UTSW	9	108,364,700 (GRCm39)	missense	possibly damaging	0.93
R4977:Lamb2	UTSW	9	108,364,846 (GRCm39)	missense	probably damaging	0.99
R5152:Lamb2	UTSW	9	108,364,937 (GRCm39)	missense	probably benign
R5499:Lamb2	UTSW	9	108,365,001 (GRCm39)	missense	possibly damaging	0.50
R5724:Lamb2	UTSW	9	108,357,950 (GRCm39)	splice site	probably null
R5932:Lamb2	UTSW	9	108,357,810 (GRCm39)	missense	probably damaging	1.00
R5997:Lamb2	UTSW	9	108,357,587 (GRCm39)	missense	possibly damaging	0.65
R6052:Lamb2	UTSW	9	108,364,811 (GRCm39)	nonsense	probably null
R6142:Lamb2	UTSW	9	108,362,817 (GRCm39)	nonsense	probably null
R6245:Lamb2	UTSW	9	108,365,398 (GRCm39)	splice site	probably null
R6531:Lamb2	UTSW	9	108,360,925 (GRCm39)	missense	possibly damaging	0.78
R6562:Lamb2	UTSW	9	108,364,207 (GRCm39)	missense	possibly damaging	0.56
R6997:Lamb2	UTSW	9	108,358,496 (GRCm39)	missense	probably damaging	1.00
R7024:Lamb2	UTSW	9	108,366,687 (GRCm39)	missense	probably benign	0.00
R7116:Lamb2	UTSW	9	108,364,522 (GRCm39)	missense	probably damaging	1.00
R7146:Lamb2	UTSW	9	108,361,283 (GRCm39)	missense	possibly damaging	0.94
R7261:Lamb2	UTSW	9	108,358,496 (GRCm39)	missense	probably damaging	1.00
R7288:Lamb2	UTSW	9	108,365,523 (GRCm39)	missense	probably benign	0.20
R7404:Lamb2	UTSW	9	108,364,782 (GRCm39)	missense	probably damaging	1.00
R7456:Lamb2	UTSW	9	108,362,979 (GRCm39)	missense	possibly damaging	0.95
R7472:Lamb2	UTSW	9	108,363,347 (GRCm39)	missense	probably benign	0.01
R7623:Lamb2	UTSW	9	108,366,423 (GRCm39)	missense	possibly damaging	0.62
R8125:Lamb2	UTSW	9	108,364,722 (GRCm39)	missense	probably benign
R8153:Lamb2	UTSW	9	108,357,845 (GRCm39)	missense	probably damaging	0.99
R8154:Lamb2	UTSW	9	108,357,845 (GRCm39)	missense	probably damaging	0.99
R8155:Lamb2	UTSW	9	108,357,845 (GRCm39)	missense	probably damaging	0.99
R8156:Lamb2	UTSW	9	108,357,845 (GRCm39)	missense	probably damaging	0.99
R8157:Lamb2	UTSW	9	108,357,845 (GRCm39)	missense	probably damaging	0.99
R8419:Lamb2	UTSW	9	108,365,563 (GRCm39)	missense	probably benign	0.00
R8695:Lamb2	UTSW	9	108,363,365 (GRCm39)	missense	probably benign	0.08
R8825:Lamb2	UTSW	9	108,362,460 (GRCm39)	missense	probably benign	0.01
R9005:Lamb2	UTSW	9	108,361,370 (GRCm39)	critical splice donor site	probably null
R9315:Lamb2	UTSW	9	108,364,366 (GRCm39)	missense	possibly damaging	0.77
R9398:Lamb2	UTSW	9	108,364,366 (GRCm39)	missense	possibly damaging	0.77
R9419:Lamb2	UTSW	9	108,356,959 (GRCm39)	missense	unknown
R9450:Lamb2	UTSW	9	108,357,760 (GRCm39)	nonsense	probably null
R9495:Lamb2	UTSW	9	108,358,006 (GRCm39)	missense	probably damaging	1.00
R9514:Lamb2	UTSW	9	108,358,006 (GRCm39)	missense	probably damaging	1.00
R9529:Lamb2	UTSW	9	108,363,477 (GRCm39)	missense	probably benign	0.05
R9532:Lamb2	UTSW	9	108,365,830 (GRCm39)	missense	probably damaging	1.00
R9534:Lamb2	UTSW	9	108,365,830 (GRCm39)	missense	probably damaging	1.00
R9734:Lamb2	UTSW	9	108,365,830 (GRCm39)	missense	probably damaging	1.00
Z1176:Lamb2	UTSW	9	108,360,100 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCCTATGACAGCATCCGAC -3'
(R):5'- AAGCATTAGCCTTGTCCAGGG -3'

Sequencing Primer
(F):5'- GACATGCCCACAGCCAGTC -3'
(R):5'- TGCCGACGAGTCTCAGACAC -3'

Posted On

2018-06-06