Mutagenetix > Incidental Mutation

Incidental Mutation 'R6526:Cntnap3'

521912

Institutional Source

Beutler Lab

Gene Symbol

Cntnap3

Ensembl Gene

ENSMUSG00000033063

Gene Name

contactin associated protein-like 3

Synonyms

MMRRC Submission

044652-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R6526 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

64736182-64903955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 64781888 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 499 (N499I)

Ref Sequence

ENSEMBL: ENSMUSP00000089140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091554]

AlphaFold

E9PY62

Predicted Effect

possibly damaging
Transcript: ENSMUST00000091554
AA Change: N499I

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: N499I

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
FA58C	33	180	4.88e-17	SMART
LamG	207	345	1.47e-11	SMART
LamG	394	525	1.43e-23	SMART
EGF	553	587	1.33e-1	SMART
FBG	590	775	6.76e-1	SMART
LamG	815	942	1.89e-32	SMART
EGF_like	963	999	6.28e1	SMART
LamG	1040	1178	9.46e-15	SMART
transmembrane domain	1245	1267	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.5%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aamp	A	G	1: 74,284,172		probably null	Het
Abcc3	C	T	11: 94,359,372	G975D	probably benign	Het
Abhd13	G	A	8: 9,987,777	G125S	probably damaging	Het
Ache	T	A	5: 137,290,644	L204Q	probably damaging	Het
Acnat2	A	G	4: 49,383,497	S19P	probably benign	Het
Adprh	A	G	16: 38,447,276	Y216H	probably benign	Het
Anapc1	T	A	2: 128,672,135	K429*	probably null	Het
Anxa13	T	C	15: 58,344,957		noncoding transcript	Het
Aprt	A	C	8: 122,576,816	L6W	probably damaging	Het
Arhgef15	T	C	11: 68,949,994	T569A	probably damaging	Het
Atp11a	T	C	8: 12,864,999	L1139P	probably benign	Het
Atp2b4	A	G	1: 133,711,729	S1136P	probably damaging	Het
B9d1	T	A	11: 61,509,097	Y90*	probably null	Het
Btla	G	A	16: 45,239,094	A54T	probably damaging	Het
Cd63	T	C	10: 128,911,489	V35A	probably benign	Het
Chek2	T	C	5: 110,848,690	F173L	probably damaging	Het
Cog4	T	C	8: 110,881,786	L738P	probably damaging	Het
Cops6	T	C	5: 138,163,900		probably null	Het
Cpeb1	T	A	7: 81,361,669	I175F	probably benign	Het
Cyp3a16	C	T	5: 145,455,895	D174N	probably benign	Het
Dnah6	T	G	6: 73,074,704	I2984L	probably benign	Het
Dock10	A	T	1: 80,586,351	I540N	probably damaging	Het
Elf5	A	G	2: 103,439,233	Y53C	probably damaging	Het
Elmod2	T	C	8: 83,319,457	T164A	probably damaging	Het
Epn3	A	G	11: 94,494,932		probably null	Het
Fam151a	A	T	4: 106,734,004	I15F	possibly damaging	Het
Gm11115	T	A	5: 88,154,050		probably null	Het
Gm13103	A	G	4: 143,852,814	D323G	probably damaging	Het
Golga3	T	A	5: 110,204,895	I884N	probably damaging	Het
Gria2	A	T	3: 80,692,469	F703I	probably damaging	Het
Gtf2h3	C	T	5: 124,584,297	T121I	probably benign	Het
Gtpbp2	A	T	17: 46,164,111		probably null	Het
Herc2	T	C	7: 56,157,330	S2419P	probably damaging	Het
Ikbkap	T	C	4: 56,798,812		probably null	Het
Inpp5d	T	C	1: 87,676,250		probably benign	Het
Kdm2b	C	A	5: 122,961,469	V136F	probably damaging	Het
Klra2	T	A	6: 131,221,876	D234V	probably benign	Het
Lct	A	T	1: 128,300,478	S1093T	probably benign	Het
March9	A	G	10: 127,056,689	L310P	probably benign	Het
Morc1	G	T	16: 48,587,124	E668*	probably null	Het
Mum1	A	G	10: 80,232,279	T86A	probably benign	Het
Nbas	A	T	12: 13,405,425	L1213F	probably damaging	Het
Neto1	A	G	18: 86,498,748	T397A	possibly damaging	Het
Oit3	A	G	10: 59,429,640	C268R	probably damaging	Het
Olfr476	A	G	7: 107,967,462	T22A	probably benign	Het
Pcx	T	C	19: 4,604,495	F312L	probably benign	Het
Pitx2	T	C	3: 129,214,783		probably null	Het
Pkhd1l1	G	A	15: 44,498,089		probably null	Het
Polr1a	C	A	6: 71,929,443	D414E	possibly damaging	Het
Prkch	T	C	12: 73,702,775	Y381H	probably damaging	Het
Ptger3	T	A	3: 157,567,502	V162E	probably damaging	Het
Ptgr2	T	G	12: 84,313,952	M332R	probably damaging	Het
Ptprq	G	T	10: 107,542,653	S2009*	probably null	Het
Rangrf	C	T	11: 68,973,688	G11R	probably damaging	Het
Rbl2	A	T	8: 91,096,839	Q465L	probably benign	Het
Rhbdd1	A	T	1: 82,340,659	M88L	probably benign	Het
Setd2	G	A	9: 110,532,717	M13I	probably benign	Het
Sirpb1a	T	C	3: 15,379,020	Y384C	probably damaging	Het
Slc13a1	C	T	6: 24,097,612	G439S	probably damaging	Het
Slc41a1	T	A	1: 131,841,149	I239N	probably damaging	Het
Slit2	T	A	5: 48,304,167	C1502S	probably damaging	Het
Slit3	G	A	11: 35,661,292	E888K	probably benign	Het
Srrm3	G	T	5: 135,835,234	R62L	probably damaging	Het
Synm	A	G	7: 67,735,583	V777A	possibly damaging	Het
Trmt13	T	A	3: 116,592,215	N31I	probably damaging	Het
Trpm8	G	A	1: 88,361,998	E893K	probably damaging	Het
Uqcc1	A	G	2: 155,851,423	F197S	probably damaging	Het
Vmn1r67	T	A	7: 10,447,671	N287K	probably benign	Het
Vmn2r44	A	T	7: 8,378,099	M265K	probably benign	Het
Wwc1	C	T	11: 35,853,437	E853K	probably benign	Het
Xdh	C	A	17: 73,900,551	C937F	probably damaging	Het
Zfp846	T	A	9: 20,593,871	N342K	probably benign	Het

Other mutations in Cntnap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Cntnap3	APN	13	64772731	missense	probably damaging	1.00
IGL00782:Cntnap3	APN	13	64745805	splice site	probably benign
IGL00976:Cntnap3	APN	13	64794352	missense	probably damaging	1.00
IGL01319:Cntnap3	APN	13	64787837	missense	probably damaging	1.00
IGL01610:Cntnap3	APN	13	64757301	missense	probably damaging	0.98
IGL01861:Cntnap3	APN	13	64799108	missense	probably damaging	1.00
IGL02127:Cntnap3	APN	13	64799064	splice site	probably benign
IGL02133:Cntnap3	APN	13	64751673	splice site	probably benign
IGL02251:Cntnap3	APN	13	64762036	missense	probably damaging	1.00
IGL02272:Cntnap3	APN	13	64757411	missense	probably damaging	1.00
IGL02370:Cntnap3	APN	13	64751751	missense	probably benign
IGL02456:Cntnap3	APN	13	64799058	splice site	probably benign
IGL02589:Cntnap3	APN	13	64792430	missense	probably benign	0.08
IGL02695:Cntnap3	APN	13	64772132	missense	probably benign	0.01
IGL02850:Cntnap3	APN	13	64757409	missense	probably damaging	1.00
IGL03038:Cntnap3	APN	13	64741025	missense	possibly damaging	0.50
IGL03188:Cntnap3	APN	13	64781745	missense	probably damaging	0.97
IGL03327:Cntnap3	APN	13	64887768	nonsense	probably null
PIT4480001:Cntnap3	UTSW	13	64757210	missense	probably damaging	1.00
R0309:Cntnap3	UTSW	13	64757436	splice site	probably benign
R0422:Cntnap3	UTSW	13	64757285	missense	probably damaging	0.96
R0463:Cntnap3	UTSW	13	64778876	missense	probably damaging	1.00
R0491:Cntnap3	UTSW	13	64762045	missense	probably benign	0.01
R0499:Cntnap3	UTSW	13	64858678	missense	probably benign	0.33
R0550:Cntnap3	UTSW	13	64762000	missense	possibly damaging	0.86
R0613:Cntnap3	UTSW	13	64758414	missense	probably damaging	1.00
R0666:Cntnap3	UTSW	13	64757397	missense	probably damaging	1.00
R0840:Cntnap3	UTSW	13	64787910	missense	possibly damaging	0.94
R1577:Cntnap3	UTSW	13	64758290	missense	probably damaging	1.00
R1716:Cntnap3	UTSW	13	64762002	missense	probably damaging	1.00
R1732:Cntnap3	UTSW	13	64740812	critical splice donor site	probably null
R1739:Cntnap3	UTSW	13	64740592	missense	probably benign	0.17
R1905:Cntnap3	UTSW	13	64903764	missense	probably benign	0.04
R1988:Cntnap3	UTSW	13	64758390	missense	probably damaging	1.00
R2086:Cntnap3	UTSW	13	64794262	missense	possibly damaging	0.76
R3732:Cntnap3	UTSW	13	64740999	missense	possibly damaging	0.73
R3808:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R3809:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R4384:Cntnap3	UTSW	13	64748460	missense	probably damaging	1.00
R4433:Cntnap3	UTSW	13	64778853	missense	possibly damaging	0.92
R4631:Cntnap3	UTSW	13	64778883	missense	probably benign	0.04
R4645:Cntnap3	UTSW	13	64778788	critical splice donor site	probably null
R4702:Cntnap3	UTSW	13	64778862	missense	probably benign	0.17
R4876:Cntnap3	UTSW	13	64787706	missense	probably benign	0.00
R4994:Cntnap3	UTSW	13	64761984	missense	possibly damaging	0.55
R5043:Cntnap3	UTSW	13	64794348	missense	probably damaging	1.00
R5214:Cntnap3	UTSW	13	64762010	missense	probably damaging	1.00
R5403:Cntnap3	UTSW	13	64761978	missense	possibly damaging	0.90
R5571:Cntnap3	UTSW	13	64903758	missense	probably damaging	0.98
R5587:Cntnap3	UTSW	13	64746738	missense	probably damaging	1.00
R5695:Cntnap3	UTSW	13	64787955	missense	probably damaging	0.99
R5834:Cntnap3	UTSW	13	64748577	missense	probably benign	0.07
R5892:Cntnap3	UTSW	13	64799180	missense	probably damaging	1.00
R5950:Cntnap3	UTSW	13	64787769	missense	probably damaging	1.00
R6954:Cntnap3	UTSW	13	64748559	missense	probably benign	0.00
R7138:Cntnap3	UTSW	13	64781725	critical splice donor site	probably null
R7355:Cntnap3	UTSW	13	64771962	missense	probably benign
R7425:Cntnap3	UTSW	13	64758252	missense	probably damaging	1.00
R7521:Cntnap3	UTSW	13	64772001	missense	probably benign	0.22
R7719:Cntnap3	UTSW	13	64772777	nonsense	probably null
R7810:Cntnap3	UTSW	13	64793308	missense	possibly damaging	0.73
R7871:Cntnap3	UTSW	13	64903773	missense	probably benign	0.00
R8259:Cntnap3	UTSW	13	64787867	missense	probably damaging	0.99
R8415:Cntnap3	UTSW	13	64738665	missense	probably benign	0.31
R8491:Cntnap3	UTSW	13	64785343	missense	probably damaging	1.00
R9086:Cntnap3	UTSW	13	64781759	missense	probably damaging	1.00
R9087:Cntnap3	UTSW	13	64751718	missense	probably damaging	0.96
R9398:Cntnap3	UTSW	13	64903834	missense	probably benign	0.41
R9475:Cntnap3	UTSW	13	64799135	missense	probably damaging	1.00
R9625:Cntnap3	UTSW	13	64858765	missense	probably damaging	1.00
R9679:Cntnap3	UTSW	13	64751748	missense	probably damaging	1.00
Z1176:Cntnap3	UTSW	13	64740872	frame shift	probably null
Z1176:Cntnap3	UTSW	13	64792388	missense	probably damaging	0.98
Z1177:Cntnap3	UTSW	13	64781892	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTACCGGTCTATGATGCCAC -3'
(R):5'- TCATAGAATGAGTTGGGTCGAGTAC -3'

Sequencing Primer
(F):5'- GTCTATGATGCCACAGGAGTCTATC -3'
(R):5'- AGTTTGTGAAGAACTGGAATTAGGTC -3'

Posted On

2018-06-06