Incidental Mutation 'R6557:Gpc5'
ID521921
Institutional Source Beutler Lab
Gene Symbol Gpc5
Ensembl Gene ENSMUSG00000022112
Gene Nameglypican 5
SynonymsA230034F01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6557 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location115092215-116525179 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 115092534 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022707] [ENSMUST00000175665] [ENSMUST00000176912]
Predicted Effect probably benign
Transcript: ENSMUST00000022707
SMART Domains Protein: ENSMUSP00000022707
Gene: ENSMUSG00000022112

DomainStartEndE-ValueType
Pfam:Glypican 9 572 1.8e-182 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000175665
AA Change: D43V
SMART Domains Protein: ENSMUSP00000135857
Gene: ENSMUSG00000022112
AA Change: D43V

DomainStartEndE-ValueType
Pfam:Glypican 82 480 1.3e-142 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000176912
AA Change: D43V
SMART Domains Protein: ENSMUSP00000135085
Gene: ENSMUSG00000022112
AA Change: D43V

DomainStartEndE-ValueType
Pfam:Glypican 85 642 1.6e-174 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176993
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell surface heparan sulfate proteoglycans are composed of a membrane-associated protein core substituted with a variable number of heparan sulfate chains. Members of the glypican-related integral membrane proteoglycan family (GRIPS) contain a core protein anchored to the cytoplasmic membrane via a glycosyl phosphatidylinositol linkage. These proteins may play a role in the control of cell division and growth regulation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cxcl15 C T 5: 90,794,566 probably benign Het
Dysf A G 6: 84,186,384 D1580G probably damaging Het
Greb1 T C 12: 16,710,383 I575V probably benign Het
Hecw1 T C 13: 14,316,646 E174G possibly damaging Het
Hip1 T C 5: 135,428,719 D300G possibly damaging Het
Ica1l T C 1: 59,997,625 T336A probably benign Het
Ikzf3 C T 11: 98,516,881 A45T probably benign Het
Krtap16-1 T C 11: 99,985,130 S483G possibly damaging Het
Lamb2 T C 9: 108,488,400 L1394P probably damaging Het
Liph T A 16: 21,983,920 E133V possibly damaging Het
Mamdc2 A G 19: 23,310,845 S610P possibly damaging Het
Map10 T C 8: 125,670,252 V128A probably damaging Het
Mon2 C A 10: 123,016,402 C1022F probably damaging Het
Nfatc3 T C 8: 106,119,354 S1039P probably benign Het
Nov A T 15: 54,747,927 R153* probably null Het
Olfr1275 T C 2: 111,231,631 H54R probably benign Het
Scaper T C 9: 55,550,850 N879S probably benign Het
Sec24d T C 3: 123,343,087 Y490H probably damaging Het
Tdrd5 T C 1: 156,300,721 K137R probably benign Het
Topaz1 A G 9: 122,748,895 N290S probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfp638 C A 6: 83,930,110 P419Q probably damaging Het
Zzz3 T A 3: 152,428,460 L385Q probably damaging Het
Other mutations in Gpc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Gpc5 APN 14 115370024 missense probably damaging 1.00
IGL01298:Gpc5 APN 14 115399188 missense probably benign 0.14
IGL01359:Gpc5 APN 14 115369750 missense possibly damaging 0.74
IGL02354:Gpc5 APN 14 115133287 nonsense probably null
IGL02361:Gpc5 APN 14 115133287 nonsense probably null
IGL02982:Gpc5 APN 14 115369988 missense probably damaging 1.00
IGL03120:Gpc5 APN 14 115370144 missense possibly damaging 0.64
R0322:Gpc5 UTSW 14 115399151 missense probably benign 0.05
R0396:Gpc5 UTSW 14 115428208 missense possibly damaging 0.91
R0555:Gpc5 UTSW 14 115552328 missense probably damaging 0.98
R0629:Gpc5 UTSW 14 115552239 missense possibly damaging 0.94
R1536:Gpc5 UTSW 14 115399250 missense probably benign 0.09
R1660:Gpc5 UTSW 14 115399279 missense probably benign 0.12
R1676:Gpc5 UTSW 14 115370098 missense probably damaging 1.00
R2328:Gpc5 UTSW 14 115788179 missense probably damaging 0.99
R3522:Gpc5 UTSW 14 116524335 missense probably benign 0.00
R3776:Gpc5 UTSW 14 115370060 missense probably benign 0.05
R3885:Gpc5 UTSW 14 115370060 missense probably benign 0.05
R3889:Gpc5 UTSW 14 115370060 missense probably benign 0.05
R3893:Gpc5 UTSW 14 115370060 missense probably benign 0.05
R4041:Gpc5 UTSW 14 115133216 missense probably damaging 1.00
R4517:Gpc5 UTSW 14 115552239 missense possibly damaging 0.94
R5068:Gpc5 UTSW 14 115417264 makesense probably null
R5639:Gpc5 UTSW 14 115092747 missense probably benign 0.13
R5730:Gpc5 UTSW 14 115788314 missense possibly damaging 0.73
R5944:Gpc5 UTSW 14 115369838 missense probably benign 0.24
R6351:Gpc5 UTSW 14 115399200 missense probably benign 0.01
R6657:Gpc5 UTSW 14 115370198 missense probably benign 0.01
R6714:Gpc5 UTSW 14 115552303 nonsense probably null
R6751:Gpc5 UTSW 14 115369951 missense probably benign 0.00
R7057:Gpc5 UTSW 14 115133242 missense possibly damaging 0.64
R7142:Gpc5 UTSW 14 115417203 missense probably benign 0.01
R7225:Gpc5 UTSW 14 115552298 missense probably damaging 1.00
R7544:Gpc5 UTSW 14 115428173 missense probably damaging 1.00
R7658:Gpc5 UTSW 14 115428208 missense possibly damaging 0.91
R7695:Gpc5 UTSW 14 115092594 missense unknown
R7785:Gpc5 UTSW 14 115417220 missense probably benign 0.00
R8116:Gpc5 UTSW 14 115399225 missense probably damaging 0.98
R8303:Gpc5 UTSW 14 115428255 missense probably benign 0.01
RF001:Gpc5 UTSW 14 115417178 missense probably benign 0.41
RF022:Gpc5 UTSW 14 115552276 missense probably damaging 1.00
Z1176:Gpc5 UTSW 14 115369964 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCTGTGAGGTCGCAAG -3'
(R):5'- GTTTCCGAACTTCTTCGCAG -3'

Sequencing Primer
(F):5'- CACAGCCTAGGTTAGTGGC -3'
(R):5'- GAACTTCTTCGCAGCTCTCCAC -3'
Posted On2018-06-06