Incidental Mutation 'R6559:Tnfaip3'
ID521955
Institutional Source Beutler Lab
Gene Symbol Tnfaip3
Ensembl Gene ENSMUSG00000019850
Gene Nametumor necrosis factor, alpha-induced protein 3
SynonymsA20, zinc finger protein A20, Tnfip3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6559 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location19000910-19015657 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19007248 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 190 (S190P)
Ref Sequence ENSEMBL: ENSMUSP00000101167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019997] [ENSMUST00000105527] [ENSMUST00000122863] [ENSMUST00000146388]
Predicted Effect probably damaging
Transcript: ENSMUST00000019997
AA Change: S190P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000019997
Gene: ENSMUSG00000019850
AA Change: S190P

DomainStartEndE-ValueType
Pfam:OTU 98 257 1.2e-30 PFAM
ZnF_A20 384 409 8.06e-9 SMART
low complexity region 425 436 N/A INTRINSIC
ZnF_A20 467 492 3.76e-9 SMART
ZnF_A20 503 526 4.74e-6 SMART
low complexity region 528 543 N/A INTRINSIC
ZnF_A20 589 614 6.01e-8 SMART
ZnF_A20 639 664 1.56e-6 SMART
ZnF_A20 698 723 1.68e-6 SMART
ZnF_A20 744 769 2.81e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105527
AA Change: S190P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101167
Gene: ENSMUSG00000019850
AA Change: S190P

DomainStartEndE-ValueType
Pfam:OTU 98 257 7.8e-34 PFAM
ZnF_A20 384 409 8.06e-9 SMART
low complexity region 425 436 N/A INTRINSIC
ZnF_A20 467 492 3.76e-9 SMART
ZnF_A20 503 526 4.74e-6 SMART
low complexity region 528 543 N/A INTRINSIC
ZnF_A20 589 614 6.01e-8 SMART
ZnF_A20 639 664 1.56e-6 SMART
ZnF_A20 698 723 1.68e-6 SMART
ZnF_A20 744 769 2.81e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122863
SMART Domains Protein: ENSMUSP00000116318
Gene: ENSMUSG00000019850

DomainStartEndE-ValueType
PDB:2VFJ|D 1 122 2e-83 PDB
SCOP:d1e3ha3 18 109 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146388
SMART Domains Protein: ENSMUSP00000120627
Gene: ENSMUSG00000019850

DomainStartEndE-ValueType
PDB:3ZJG|B 1 87 1e-56 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154749
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified as a gene whose expression is rapidly induced by the tumor necrosis factor (TNF). The protein encoded by this gene is a zinc finger protein and ubiqitin-editing enzyme, and has been shown to inhibit NF-kappa B activation as well as TNF-mediated apoptosis. The encoded protein, which has both ubiquitin ligase and deubiquitinase activities, is involved in the cytokine-mediated immune and inflammatory responses. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display runting, severe multi-organ inflammation, hypersensitivity to lipopolysaccharide and TNF, and premature death. Older mice homozygous for point mutations that disrupt deubiquitinating activity develop splenomegaly and show an increased number of myeloid cells. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik C T 4: 109,505,805 V106I possibly damaging Het
Actn4 T C 7: 28,907,036 K284R possibly damaging Het
Adam20 G C 8: 40,796,292 E480Q probably benign Het
Armc4 T C 18: 7,223,664 T460A probably damaging Het
Cdkl3 A G 11: 52,025,869 T275A probably benign Het
Dync2h1 A G 9: 7,139,501 I1378T possibly damaging Het
Fam186a A G 15: 99,944,475 I1296T possibly damaging Het
Fbf1 G A 11: 116,155,446 T193M probably benign Het
Fcrl1 A G 3: 87,391,253 I352V probably benign Het
Ifit3 T C 19: 34,587,114 F20S probably damaging Het
Klhl3 G A 13: 58,016,476 R431W probably damaging Het
Lipi A G 16: 75,541,094 V464A probably benign Het
Lrp6 T C 6: 134,513,254 I120M probably damaging Het
Mst1r A G 9: 107,908,271 N376S possibly damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Ncoa2 G A 1: 13,150,617 probably null Het
Olfr250 A G 9: 38,367,756 Y60C probably damaging Het
Olfr811 A T 10: 129,801,664 I287N probably damaging Het
Teddm1a A T 1: 153,892,365 I192F probably benign Het
Ttc3 T C 16: 94,422,349 probably null Het
Zfp112 C T 7: 24,126,463 Q619* probably null Het
Zscan4-ps3 A G 7: 11,610,412 E99G probably damaging Het
Other mutations in Tnfaip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
lasvegas APN 10 19010758 unclassified probably benign
IGL00840:Tnfaip3 APN 10 19005126 missense probably damaging 1.00
IGL00966:Tnfaip3 APN 10 19005137 missense probably damaging 1.00
IGL01080:Tnfaip3 APN 10 19011655 missense probably benign 0.03
IGL01736:Tnfaip3 APN 10 19006901 missense probably damaging 1.00
IGL02318:Tnfaip3 APN 10 19004467 missense probably benign 0.04
IGL02703:Tnfaip3 APN 10 19007032 missense probably damaging 0.98
IGL03032:Tnfaip3 APN 10 19004609 missense probably benign
IGL03331:Tnfaip3 APN 10 19011601 missense possibly damaging 0.63
IGL03389:Tnfaip3 APN 10 19004987 missense probably benign 0.03
PIT4243001:Tnfaip3 UTSW 10 19011574 missense probably damaging 1.00
PIT4480001:Tnfaip3 UTSW 10 19007323 missense probably benign
R0044:Tnfaip3 UTSW 10 19011626 missense probably damaging 0.98
R0044:Tnfaip3 UTSW 10 19011626 missense probably damaging 0.98
R0056:Tnfaip3 UTSW 10 19005293 missense probably damaging 1.00
R0195:Tnfaip3 UTSW 10 19005713 missense probably damaging 1.00
R0226:Tnfaip3 UTSW 10 19002747 missense probably damaging 1.00
R0369:Tnfaip3 UTSW 10 19006912 nonsense probably null
R0744:Tnfaip3 UTSW 10 19002949 missense probably benign 0.09
R0833:Tnfaip3 UTSW 10 19002949 missense probably benign 0.09
R1469:Tnfaip3 UTSW 10 19008269 missense probably damaging 1.00
R1469:Tnfaip3 UTSW 10 19008269 missense probably damaging 1.00
R1876:Tnfaip3 UTSW 10 19004934 missense possibly damaging 0.81
R1902:Tnfaip3 UTSW 10 19008189 missense probably benign 0.19
R1903:Tnfaip3 UTSW 10 19008189 missense probably benign 0.19
R1922:Tnfaip3 UTSW 10 19003607 missense possibly damaging 0.51
R1973:Tnfaip3 UTSW 10 19004504 missense probably damaging 0.98
R2040:Tnfaip3 UTSW 10 19008152 missense possibly damaging 0.89
R2513:Tnfaip3 UTSW 10 19005659 missense probably benign 0.00
R2936:Tnfaip3 UTSW 10 19011609 missense probably damaging 1.00
R3607:Tnfaip3 UTSW 10 19005602 missense probably damaging 1.00
R4386:Tnfaip3 UTSW 10 19007010 missense probably damaging 1.00
R4483:Tnfaip3 UTSW 10 19011627 missense probably damaging 1.00
R4673:Tnfaip3 UTSW 10 19011832 intron probably benign
R4879:Tnfaip3 UTSW 10 19005573 missense probably benign 0.03
R5082:Tnfaip3 UTSW 10 19005284 missense probably damaging 1.00
R5524:Tnfaip3 UTSW 10 19008195 missense probably damaging 0.98
R6776:Tnfaip3 UTSW 10 19005576 missense probably benign 0.02
R6853:Tnfaip3 UTSW 10 19003751 missense probably benign
R6891:Tnfaip3 UTSW 10 19011669 missense probably damaging 1.00
R7144:Tnfaip3 UTSW 10 19007281 missense probably benign 0.00
R7693:Tnfaip3 UTSW 10 19004780 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGATGCTCCCTCCACTGTAG -3'
(R):5'- TCAGTTTTGAGCTTGCCCAG -3'

Sequencing Primer
(F):5'- TGTAGGCTGACAGCTGCAG -3'
(R):5'- CCGAGGATGAACATTCTTTTGATG -3'
Posted On2018-06-06