Incidental Mutation 'R6527:Ppp1r9a'
ID 521962
Institutional Source Beutler Lab
Gene Symbol Ppp1r9a
Ensembl Gene ENSMUSG00000032827
Gene Name protein phosphatase 1, regulatory subunit 9A
Synonyms NRB, neurabin-I, Neurabin I, A230094E16Rik, 4930518N04Rik, 2810430P21Rik
MMRRC Submission 044653-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.499) question?
Stock # R6527 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 4902917-5165661 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 5045949 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 151 (Y151C)
Ref Sequence ENSEMBL: ENSMUSP00000134909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035813] [ENSMUST00000168998] [ENSMUST00000175889] [ENSMUST00000176263] [ENSMUST00000176729] [ENSMUST00000177153] [ENSMUST00000177456]
AlphaFold H3BJD6
Predicted Effect probably damaging
Transcript: ENSMUST00000035813
AA Change: Y471C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046906
Gene: ENSMUSG00000032827
AA Change: Y471C

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 5e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
SAM 986 1052 6.41e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164110
Predicted Effect possibly damaging
Transcript: ENSMUST00000168998
AA Change: Y471C

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126643
Gene: ENSMUSG00000032827
AA Change: Y471C

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175889
AA Change: Y471C

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135629
Gene: ENSMUSG00000032827
AA Change: Y471C

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 2e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
SAM 986 1041 1.72e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176263
AA Change: Y471C

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134937
Gene: ENSMUSG00000032827
AA Change: Y471C

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
low complexity region 643 649 N/A INTRINSIC
Blast:PDZ 763 800 2e-15 BLAST
low complexity region 806 820 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176729
AA Change: Y151C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134909
Gene: ENSMUSG00000032827
AA Change: Y151C

DomainStartEndE-ValueType
low complexity region 96 115 N/A INTRINSIC
PDB:3HVQ|D 116 232 4e-79 PDB
SCOP:d1be9a_ 174 232 5e-9 SMART
Blast:PDZ 193 232 1e-18 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000177153
AA Change: Y471C

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135485
Gene: ENSMUSG00000032827
AA Change: Y471C

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 2e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000177456
AA Change: Y471C

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134943
Gene: ENSMUSG00000032827
AA Change: Y471C

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 2e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
low complexity region 966 987 N/A INTRINSIC
low complexity region 1040 1049 N/A INTRINSIC
low complexity region 1103 1114 N/A INTRINSIC
SAM 1183 1249 6.41e-16 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is imprinted, and located in a cluster of imprinted genes on chromosome 7q12. This gene is transcribed in both neuronal and multiple embryonic tissues, and it is maternally expressed mainly in embryonic skeletal muscle tissues and biallelically expressed in other embryonic tissues. The protein encoded by this gene includes a PDZ domain and a sterile alpha motif (SAM). It is a regulatory subunit of protein phosphatase I, and controls actin cytoskeleton reorganization. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defects in dopamine-mediated neuromodulation, deficient long-term potentiation at corticostriatal synapses, increased spontaneous excitatory post-synaptic current frequency, and enhanced locomotor activationin response to cocaine treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 137,773,288 (GRCm39) T826A probably damaging Het
Abca16 T A 7: 120,076,995 (GRCm39) I686N possibly damaging Het
Abcb6 T C 1: 75,154,132 (GRCm39) probably null Het
Adgrl3 A C 5: 81,935,364 (GRCm39) E1299A probably damaging Het
Amd2 A C 10: 35,586,802 (GRCm39) Y252D probably damaging Het
Cfap74 A G 4: 155,506,722 (GRCm39) probably null Het
Dhx29 G T 13: 113,069,076 (GRCm39) K135N probably damaging Het
Dlg5 T A 14: 24,240,516 (GRCm39) D245V possibly damaging Het
Dscaml1 C T 9: 45,623,482 (GRCm39) Q83* probably null Het
Dsp T A 13: 38,379,849 (GRCm39) L1599Q probably damaging Het
Duox2 A G 2: 122,125,095 (GRCm39) V369A probably benign Het
Flacc1 T C 1: 58,731,572 (GRCm39) M1V probably null Het
Gbe1 T A 16: 70,230,560 (GRCm39) probably null Het
Gm7298 A G 6: 121,746,669 (GRCm39) K600R probably benign Het
Heatr4 C T 12: 84,026,537 (GRCm39) G240E probably damaging Het
Jakmip2 A G 18: 43,689,589 (GRCm39) V651A possibly damaging Het
Jam3 C T 9: 27,066,640 (GRCm39) R8Q unknown Het
Letm2 A G 8: 26,082,522 (GRCm39) probably benign Het
Lmod3 T C 6: 97,224,339 (GRCm39) D494G probably benign Het
Mast2 T C 4: 116,172,136 (GRCm39) D604G probably damaging Het
Mif4gd C T 11: 115,500,101 (GRCm39) probably null Het
Msr1 T C 8: 40,077,274 (GRCm39) E112G possibly damaging Het
Mtus2 A G 5: 148,214,408 (GRCm39) probably null Het
Muc4 A G 16: 32,753,433 (GRCm38) H1103R probably benign Het
Nudt14 T A 12: 112,898,507 (GRCm39) I198F possibly damaging Het
Or11j4 T A 14: 50,630,885 (GRCm39) L224* probably null Het
Or13p3 T A 4: 118,567,045 (GRCm39) F147Y possibly damaging Het
Or1n1b T C 2: 36,780,594 (GRCm39) T89A probably benign Het
Osbpl8 T C 10: 111,129,066 (GRCm39) I884T probably benign Het
Podxl2 T C 6: 88,819,912 (GRCm39) N550S probably damaging Het
Prss42 T C 9: 110,629,924 (GRCm39) V226A possibly damaging Het
Psmd12 A G 11: 107,379,794 (GRCm39) I116V probably damaging Het
Psme4 A C 11: 30,782,175 (GRCm39) I872L probably benign Het
Rab11fip1 A T 8: 27,664,420 (GRCm39) V65E probably damaging Het
Ros1 T C 10: 52,019,473 (GRCm39) N700S possibly damaging Het
Slc15a4 G A 5: 127,673,773 (GRCm39) T547M probably damaging Het
Slfn3 T A 11: 83,103,932 (GRCm39) C268S probably benign Het
Smc5 T C 19: 23,205,554 (GRCm39) Q794R probably benign Het
Sqor A G 2: 122,651,206 (GRCm39) Y434C probably damaging Het
Steap4 T A 5: 8,028,502 (GRCm39) L360H probably damaging Het
Sycp1 A G 3: 102,806,203 (GRCm39) V496A probably benign Het
Tmem161b T G 13: 84,420,383 (GRCm39) M128R probably benign Het
Tmem59l T C 8: 70,938,775 (GRCm39) E102G probably damaging Het
Tnks A T 8: 35,340,247 (GRCm39) V457D probably benign Het
Tomt A G 7: 101,549,599 (GRCm39) Y230H probably damaging Het
Trim37 A G 11: 87,080,910 (GRCm39) N561D probably damaging Het
V1ra8 T A 6: 90,180,295 (GRCm39) I166K probably damaging Het
Vmn1r56 A G 7: 5,199,575 (GRCm39) V14A probably benign Het
Vsig8 T C 1: 172,387,925 (GRCm39) V5A possibly damaging Het
Vwa8 A T 14: 79,184,653 (GRCm39) S384C possibly damaging Het
Wwc1 C T 11: 35,744,264 (GRCm39) E853K probably benign Het
Zfp984 T C 4: 147,840,381 (GRCm39) N157D probably benign Het
Zzef1 G A 11: 72,765,816 (GRCm39) D1448N probably benign Het
Other mutations in Ppp1r9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Ppp1r9a APN 6 5,158,195 (GRCm39) missense possibly damaging 0.72
IGL00796:Ppp1r9a APN 6 5,157,014 (GRCm39) missense probably benign 0.37
IGL00906:Ppp1r9a APN 6 5,157,023 (GRCm39) missense possibly damaging 0.62
IGL01662:Ppp1r9a APN 6 5,115,322 (GRCm39) missense probably damaging 1.00
IGL01695:Ppp1r9a APN 6 5,064,003 (GRCm39) missense probably damaging 1.00
IGL01807:Ppp1r9a APN 6 5,158,248 (GRCm39) nonsense probably null
IGL02126:Ppp1r9a APN 6 5,156,229 (GRCm39) missense probably damaging 1.00
IGL02423:Ppp1r9a APN 6 4,906,537 (GRCm39) missense probably benign 0.25
IGL03343:Ppp1r9a APN 6 5,046,015 (GRCm39) missense probably damaging 1.00
IGL03365:Ppp1r9a APN 6 5,110,993 (GRCm39) splice site probably benign
R0545:Ppp1r9a UTSW 6 5,115,357 (GRCm39) missense probably benign 0.45
R1126:Ppp1r9a UTSW 6 4,906,795 (GRCm39) missense possibly damaging 0.93
R1137:Ppp1r9a UTSW 6 5,159,697 (GRCm39) missense possibly damaging 0.46
R1443:Ppp1r9a UTSW 6 5,057,557 (GRCm39) missense probably damaging 1.00
R1484:Ppp1r9a UTSW 6 5,113,712 (GRCm39) nonsense probably null
R1545:Ppp1r9a UTSW 6 5,156,242 (GRCm39) critical splice donor site probably null
R1627:Ppp1r9a UTSW 6 4,906,168 (GRCm39) missense possibly damaging 0.50
R1672:Ppp1r9a UTSW 6 5,143,491 (GRCm39) critical splice donor site probably null
R1826:Ppp1r9a UTSW 6 5,111,060 (GRCm39) splice site probably benign
R1834:Ppp1r9a UTSW 6 5,113,710 (GRCm39) missense probably damaging 0.98
R1874:Ppp1r9a UTSW 6 4,906,348 (GRCm39) missense possibly damaging 0.87
R2224:Ppp1r9a UTSW 6 5,154,074 (GRCm39) missense probably benign
R2227:Ppp1r9a UTSW 6 5,154,074 (GRCm39) missense probably benign
R2898:Ppp1r9a UTSW 6 4,906,558 (GRCm39) missense probably benign 0.01
R3606:Ppp1r9a UTSW 6 5,113,674 (GRCm39) missense possibly damaging 0.90
R3732:Ppp1r9a UTSW 6 4,906,259 (GRCm39) unclassified probably benign
R3927:Ppp1r9a UTSW 6 5,057,531 (GRCm39) missense probably damaging 1.00
R4631:Ppp1r9a UTSW 6 4,906,537 (GRCm39) missense possibly damaging 0.62
R4682:Ppp1r9a UTSW 6 4,905,477 (GRCm39) missense possibly damaging 0.48
R4766:Ppp1r9a UTSW 6 5,157,016 (GRCm39) missense probably benign 0.11
R5197:Ppp1r9a UTSW 6 5,156,177 (GRCm39) missense probably damaging 1.00
R5217:Ppp1r9a UTSW 6 5,115,367 (GRCm39) missense probably damaging 1.00
R5493:Ppp1r9a UTSW 6 5,159,702 (GRCm39) missense probably damaging 0.99
R5790:Ppp1r9a UTSW 6 5,134,363 (GRCm39) intron probably benign
R5828:Ppp1r9a UTSW 6 5,158,200 (GRCm39) missense probably damaging 1.00
R5896:Ppp1r9a UTSW 6 5,159,648 (GRCm39) missense probably damaging 1.00
R5930:Ppp1r9a UTSW 6 5,157,002 (GRCm39) critical splice acceptor site probably null
R5990:Ppp1r9a UTSW 6 5,134,660 (GRCm39) missense probably benign 0.05
R6017:Ppp1r9a UTSW 6 4,906,363 (GRCm39) missense probably benign 0.18
R6122:Ppp1r9a UTSW 6 4,905,509 (GRCm39) missense probably damaging 1.00
R6164:Ppp1r9a UTSW 6 5,110,715 (GRCm39) intron probably benign
R6175:Ppp1r9a UTSW 6 4,905,639 (GRCm39) nonsense probably null
R6188:Ppp1r9a UTSW 6 5,158,113 (GRCm39) nonsense probably null
R6233:Ppp1r9a UTSW 6 5,077,610 (GRCm39) missense probably damaging 1.00
R6321:Ppp1r9a UTSW 6 5,115,151 (GRCm39) missense probably damaging 1.00
R6449:Ppp1r9a UTSW 6 5,057,458 (GRCm39) missense probably benign 0.44
R6454:Ppp1r9a UTSW 6 4,905,827 (GRCm39) missense probably damaging 1.00
R7053:Ppp1r9a UTSW 6 4,905,670 (GRCm39) missense probably damaging 1.00
R7233:Ppp1r9a UTSW 6 5,134,804 (GRCm39) missense probably benign
R7238:Ppp1r9a UTSW 6 5,159,716 (GRCm39) missense probably damaging 1.00
R7438:Ppp1r9a UTSW 6 5,115,378 (GRCm39) missense probably damaging 0.99
R7497:Ppp1r9a UTSW 6 4,905,775 (GRCm39) missense probably damaging 1.00
R7666:Ppp1r9a UTSW 6 5,143,238 (GRCm39) missense probably benign 0.00
R7698:Ppp1r9a UTSW 6 4,906,430 (GRCm39) missense probably benign
R7850:Ppp1r9a UTSW 6 4,905,894 (GRCm39) missense possibly damaging 0.77
R8029:Ppp1r9a UTSW 6 5,057,518 (GRCm39) missense possibly damaging 0.76
R8392:Ppp1r9a UTSW 6 5,143,491 (GRCm39) critical splice donor site probably null
R8411:Ppp1r9a UTSW 6 5,057,568 (GRCm39) missense probably damaging 1.00
R8431:Ppp1r9a UTSW 6 5,115,456 (GRCm39) missense probably benign 0.01
R8699:Ppp1r9a UTSW 6 5,115,474 (GRCm39) missense probably benign 0.00
R8708:Ppp1r9a UTSW 6 5,115,196 (GRCm39) missense probably damaging 1.00
R9039:Ppp1r9a UTSW 6 5,134,657 (GRCm39) missense probably benign 0.00
R9096:Ppp1r9a UTSW 6 4,906,012 (GRCm39) missense probably damaging 1.00
R9097:Ppp1r9a UTSW 6 4,906,012 (GRCm39) missense probably damaging 1.00
R9131:Ppp1r9a UTSW 6 5,134,106 (GRCm39) missense possibly damaging 0.86
R9279:Ppp1r9a UTSW 6 5,113,757 (GRCm39) missense probably damaging 1.00
R9512:Ppp1r9a UTSW 6 5,115,364 (GRCm39) missense probably damaging 0.99
R9512:Ppp1r9a UTSW 6 5,113,681 (GRCm39) missense probably benign 0.27
R9567:Ppp1r9a UTSW 6 5,157,004 (GRCm39) missense probably benign 0.34
R9672:Ppp1r9a UTSW 6 5,007,889 (GRCm39) missense unknown
R9687:Ppp1r9a UTSW 6 4,905,978 (GRCm39) missense probably damaging 1.00
R9715:Ppp1r9a UTSW 6 5,045,936 (GRCm39) missense probably damaging 0.96
RF007:Ppp1r9a UTSW 6 4,906,657 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTTAGGAGAAAGGTATCAGCGAC -3'
(R):5'- CAATAATGTTACCAGCACAGACATG -3'

Sequencing Primer
(F):5'- TCCAGTTTGAGTGAGAGACCC -3'
(R):5'- TGAAAATGCGCACACTGGAATC -3'
Posted On 2018-06-06