Mutagenetix > Incidental Mutation

Incidental Mutation 'R6527:Lmod3'

521968

Institutional Source

Beutler Lab

Gene Symbol

Lmod3

Ensembl Gene

ENSMUSG00000044086

Gene Name

leiomodin 3 (fetal)

Synonyms

5430424A14Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.123) question?

Stock #

R6527 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

97238534-97252759 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 97247378 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 494 (D494G)

Ref Sequence

ENSEMBL: ENSMUSP00000093315 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095655]

AlphaFold

E9QA62

Predicted Effect

probably benign
Transcript: ENSMUST00000095655
AA Change: D494G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000093315
Gene: ENSMUSG00000044086
AA Change: D494G

Domain	Start	End	E-Value	Type
Pfam:Tropomodulin	8	177	1.2e-13	PFAM
PDB:1IO0\|A	248	406	9e-46	PDB
SCOP:d1a4ya_	261	358	1e-3	SMART
low complexity region	407	427	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the leiomodin family of proteins. This protein contains three actin-binding domains, a tropomyosin domain, a leucine-rich repeat domain, and a Wiskott-Aldrich syndrome protein homology 2 domain (WH2). Localization of this protein to the pointed ends of thin filaments has been observed, and there is evidence that this protein acts as a catalyst of actin nucleation, and is important to the organization of sarcomeric thin filaments in skeletal muscles. Mutations in this gene have been associated as one cause of Nemaline myopathy, as other genes have also been linked to this disorder. Nemaline myopathy is a disorder characterized by nonprogressive generalized muscle weakness and protein inclusions (nemaline bodies) in skeletal myofibers. Patients with mutations in this gene often present with a severe congenital form of the disorder. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for an endonuclease-mediated mutation are runted and exhibit nemaline myopathy including a reduction in skeletal myofiber size, centrally nucleated skeletal muscle fibers, increase in skeletal muscle glycogen levels, and abnormal sarcomere and Z lines. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,067,527	T826A	probably damaging	Het
Abca16	T	A	7: 120,477,772	I686N	possibly damaging	Het
Abcb6	T	C	1: 75,177,488		probably null	Het
Adgrl3	A	C	5: 81,787,517	E1299A	probably damaging	Het
Als2cr12	T	C	1: 58,692,413	M1V	probably null	Het
Amd2	A	C	10: 35,710,806	Y252D	probably damaging	Het
Cfap74	A	G	4: 155,422,265		probably null	Het
Dhx29	G	T	13: 112,932,542	K135N	probably damaging	Het
Dlg5	T	A	14: 24,190,448	D245V	possibly damaging	Het
Dscaml1	C	T	9: 45,712,184	Q83*	probably null	Het
Dsp	T	A	13: 38,195,873	L1599Q	probably damaging	Het
Duox2	A	G	2: 122,294,614	V369A	probably benign	Het
Gbe1	T	A	16: 70,433,672		probably null	Het
Gm7298	A	G	6: 121,769,710	K600R	probably benign	Het
Heatr4	C	T	12: 83,979,763	G240E	probably damaging	Het
Jakmip2	A	G	18: 43,556,524	V651A	possibly damaging	Het
Jam3	C	T	9: 27,155,344	R8Q	unknown	Het
Letm2	A	G	8: 25,592,506		probably benign	Het
Mast2	T	C	4: 116,314,939	D604G	probably damaging	Het
Mif4gd	C	T	11: 115,609,275		probably null	Het
Msr1	T	C	8: 39,624,233	E112G	possibly damaging	Het
Mtus2	A	G	5: 148,277,598		probably null	Het
Muc4	A	G	16: 32,753,433	H1103R	probably benign	Het
Nudt14	T	A	12: 112,934,887	I198F	possibly damaging	Het
Olfr1341	T	A	4: 118,709,848	F147Y	possibly damaging	Het
Olfr353	T	C	2: 36,890,582	T89A	probably benign	Het
Olfr736	T	A	14: 50,393,428	L224*	probably null	Het
Osbpl8	T	C	10: 111,293,205	I884T	probably benign	Het
Podxl2	T	C	6: 88,842,930	N550S	probably damaging	Het
Ppp1r9a	A	G	6: 5,045,949	Y151C	probably damaging	Het
Prss42	T	C	9: 110,800,856	V226A	possibly damaging	Het
Psmd12	A	G	11: 107,488,968	I116V	probably damaging	Het
Psme4	A	C	11: 30,832,175	I872L	probably benign	Het
Rab11fip1	A	T	8: 27,174,392	V65E	probably damaging	Het
Ros1	T	C	10: 52,143,377	N700S	possibly damaging	Het
Slc15a4	G	A	5: 127,596,709	T547M	probably damaging	Het
Slfn3	T	A	11: 83,213,106	C268S	probably benign	Het
Smc5	T	C	19: 23,228,190	Q794R	probably benign	Het
Sqor	A	G	2: 122,809,286	Y434C	probably damaging	Het
Steap4	T	A	5: 7,978,502	L360H	probably damaging	Het
Sycp1	A	G	3: 102,898,887	V496A	probably benign	Het
Tmem161b	T	G	13: 84,272,264	M128R	probably benign	Het
Tmem59l	T	C	8: 70,486,125	E102G	probably damaging	Het
Tnks	A	T	8: 34,873,093	V457D	probably benign	Het
Tomt	A	G	7: 101,900,392	Y230H	probably damaging	Het
Trim37	A	G	11: 87,190,084	N561D	probably damaging	Het
V1ra8	T	A	6: 90,203,313	I166K	probably damaging	Het
Vmn1r56	A	G	7: 5,196,576	V14A	probably benign	Het
Vsig8	T	C	1: 172,560,358	V5A	possibly damaging	Het
Vwa8	A	T	14: 78,947,213	S384C	possibly damaging	Het
Wwc1	C	T	11: 35,853,437	E853K	probably benign	Het
Zfp984	T	C	4: 147,755,924	N157D	probably benign	Het
Zzef1	G	A	11: 72,874,990	D1448N	probably benign	Het

Other mutations in Lmod3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Lmod3	APN	6	97252297	missense	probably damaging	0.99
IGL00465:Lmod3	APN	6	97247861	missense	probably damaging	1.00
IGL01401:Lmod3	APN	6	97252552	missense	probably damaging	1.00
IGL02279:Lmod3	APN	6	97247672	missense	probably damaging	1.00
IGL02621:Lmod3	APN	6	97238835	utr 3 prime	probably benign
IGL03116:Lmod3	APN	6	97247195	missense	possibly damaging	0.92
Runted	UTSW	6	97247273	missense	probably damaging	1.00
R0086:Lmod3	UTSW	6	97247345	missense	probably damaging	1.00
R0627:Lmod3	UTSW	6	97248071	missense	probably damaging	0.96
R2208:Lmod3	UTSW	6	97247877	missense	probably benign	0.06
R4038:Lmod3	UTSW	6	97248314	missense	probably benign	0.06
R4913:Lmod3	UTSW	6	97247164	splice site	probably null
R5867:Lmod3	UTSW	6	97248002	missense	probably damaging	1.00
R5905:Lmod3	UTSW	6	97247614	missense	probably damaging	1.00
R6035:Lmod3	UTSW	6	97247273	missense	probably damaging	1.00
R6035:Lmod3	UTSW	6	97247273	missense	probably damaging	1.00
R6183:Lmod3	UTSW	6	97252553	missense	probably damaging	1.00
R6210:Lmod3	UTSW	6	97247301	missense	probably damaging	1.00
R7225:Lmod3	UTSW	6	97247384	missense	probably benign	0.34
R7531:Lmod3	UTSW	6	97248442	missense	probably benign	0.01
R7908:Lmod3	UTSW	6	97248473	missense	probably benign	0.05
R8022:Lmod3	UTSW	6	97248299	missense	probably benign
R8154:Lmod3	UTSW	6	97247980	missense	probably damaging	1.00
R8325:Lmod3	UTSW	6	97247418	missense	probably benign	0.06
R9149:Lmod3	UTSW	6	97247664	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGGATGTCATTCAAGAGCTGG -3'
(R):5'- GCAGCAGCAACTTAAAGAGC -3'

Sequencing Primer
(F):5'- GTCTCTGGGAGTGATTTCCACCAG -3'
(R):5'- GCTGATAGCTATGTTGGAGAATG -3'

Posted On

2018-06-06