Mutagenetix > Incidental Mutations

Incidental Mutation 'R6559:Ifit3'

521976

Institutional Source

Beutler Lab

Gene Symbol

Ifit3

Ensembl Gene

ENSMUSG00000074896

Gene Name

interferon-induced protein with tetratricopeptide repeats 3

Synonyms

Ifi49

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6559 (G1)

Quality Score

159.009

Status

Not validated

Chromosome

Chromosomal Location

34583531-34588731 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 34587114 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 20 (F20S)

Ref Sequence

ENSEMBL: ENSMUSP00000099889 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102825]

AlphaFold

Q64345

Predicted Effect

probably damaging
Transcript: ENSMUST00000102825
AA Change: F20S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000099889
Gene: ENSMUSG00000074896
AA Change: F20S

Domain	Start	End	E-Value	Type
TPR	51	84	7.69e1	SMART
TPR	94	127	2.84e1	SMART
TPR	136	169	5.69e0	SMART
Blast:TPR	170	206	6e-6	BLAST
low complexity region	209	218	N/A	INTRINSIC
TPR	241	274	1.02e1	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522H14Rik	C	T	4: 109,505,805	V106I	possibly damaging	Het
Actn4	T	C	7: 28,907,036	K284R	possibly damaging	Het
Adam20	G	C	8: 40,796,292	E480Q	probably benign	Het
Armc4	T	C	18: 7,223,664	T460A	probably damaging	Het
Cdkl3	A	G	11: 52,025,869	T275A	probably benign	Het
Dync2h1	A	G	9: 7,139,501	I1378T	possibly damaging	Het
Fam186a	A	G	15: 99,944,475	I1296T	possibly damaging	Het
Fbf1	G	A	11: 116,155,446	T193M	probably benign	Het
Fcrl1	A	G	3: 87,391,253	I352V	probably benign	Het
Klhl3	G	A	13: 58,016,476	R431W	probably damaging	Het
Lipi	A	G	16: 75,541,094	V464A	probably benign	Het
Lrp6	T	C	6: 134,513,254	I120M	probably damaging	Het
Mst1r	A	G	9: 107,908,271	N376S	possibly damaging	Het
Myo1c	C	T	11: 75,671,635	P918S	probably benign	Het
Ncoa2	G	A	1: 13,150,617		probably null	Het
Olfr250	A	G	9: 38,367,756	Y60C	probably damaging	Het
Olfr811	A	T	10: 129,801,664	I287N	probably damaging	Het
Teddm1a	A	T	1: 153,892,365	I192F	probably benign	Het
Tnfaip3	A	G	10: 19,007,248	S190P	probably damaging	Het
Ttc3	T	C	16: 94,422,349		probably null	Het
Zfp112	C	T	7: 24,126,463	Q619*	probably null	Het
Zscan4-ps3	A	G	7: 11,610,412	E99G	probably damaging	Het

Other mutations in Ifit3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R1501:Ifit3	UTSW	19	34588251	missense	probably benign	0.13
R1521:Ifit3	UTSW	19	34587173	missense	probably damaging	1.00
R3084:Ifit3	UTSW	19	34587240	missense	probably damaging	0.99
R5017:Ifit3	UTSW	19	34587192	missense	possibly damaging	0.78
R5306:Ifit3	UTSW	19	34587807	missense	probably damaging	1.00
R6194:Ifit3	UTSW	19	34587627	missense	probably benign	0.06
R6523:Ifit3	UTSW	19	34588155	missense	probably benign	0.10
R7535:Ifit3	UTSW	19	34587880	missense	probably damaging	0.98
R7947:Ifit3	UTSW	19	34587959	nonsense	probably null
R8049:Ifit3	UTSW	19	34588080	missense	possibly damaging	0.88
R8142:Ifit3	UTSW	19	34587501	missense	probably damaging	1.00
R8850:Ifit3	UTSW	19	34587588	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGTCATGACTCCGACACCC -3'
(R):5'- GATTGATCATTGTGCTCTGACTTC -3'

Sequencing Primer
(F):5'- TTTGTGGGTGCTCATCAC -3'
(R):5'- CTTAAATCTTCAGCTTGCCCTAAG -3'

Posted On

2018-06-06