Incidental Mutation 'R6559:Ifit3'
ID 521976
Institutional Source Beutler Lab
Gene Symbol Ifit3
Ensembl Gene ENSMUSG00000074896
Gene Name interferon-induced protein with tetratricopeptide repeats 3
Synonyms Ifi49
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6559 (G1)
Quality Score 159.009
Status Not validated
Chromosome 19
Chromosomal Location 34583531-34588731 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34587114 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 20 (F20S)
Ref Sequence ENSEMBL: ENSMUSP00000099889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102825]
AlphaFold Q64345
Predicted Effect probably damaging
Transcript: ENSMUST00000102825
AA Change: F20S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099889
Gene: ENSMUSG00000074896
AA Change: F20S

DomainStartEndE-ValueType
TPR 51 84 7.69e1 SMART
TPR 94 127 2.84e1 SMART
TPR 136 169 5.69e0 SMART
Blast:TPR 170 206 6e-6 BLAST
low complexity region 209 218 N/A INTRINSIC
TPR 241 274 1.02e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik C T 4: 109,505,805 V106I possibly damaging Het
Actn4 T C 7: 28,907,036 K284R possibly damaging Het
Adam20 G C 8: 40,796,292 E480Q probably benign Het
Armc4 T C 18: 7,223,664 T460A probably damaging Het
Cdkl3 A G 11: 52,025,869 T275A probably benign Het
Dync2h1 A G 9: 7,139,501 I1378T possibly damaging Het
Fam186a A G 15: 99,944,475 I1296T possibly damaging Het
Fbf1 G A 11: 116,155,446 T193M probably benign Het
Fcrl1 A G 3: 87,391,253 I352V probably benign Het
Klhl3 G A 13: 58,016,476 R431W probably damaging Het
Lipi A G 16: 75,541,094 V464A probably benign Het
Lrp6 T C 6: 134,513,254 I120M probably damaging Het
Mst1r A G 9: 107,908,271 N376S possibly damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Ncoa2 G A 1: 13,150,617 probably null Het
Olfr250 A G 9: 38,367,756 Y60C probably damaging Het
Olfr811 A T 10: 129,801,664 I287N probably damaging Het
Teddm1a A T 1: 153,892,365 I192F probably benign Het
Tnfaip3 A G 10: 19,007,248 S190P probably damaging Het
Ttc3 T C 16: 94,422,349 probably null Het
Zfp112 C T 7: 24,126,463 Q619* probably null Het
Zscan4-ps3 A G 7: 11,610,412 E99G probably damaging Het
Other mutations in Ifit3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1501:Ifit3 UTSW 19 34588251 missense probably benign 0.13
R1521:Ifit3 UTSW 19 34587173 missense probably damaging 1.00
R3084:Ifit3 UTSW 19 34587240 missense probably damaging 0.99
R5017:Ifit3 UTSW 19 34587192 missense possibly damaging 0.78
R5306:Ifit3 UTSW 19 34587807 missense probably damaging 1.00
R6194:Ifit3 UTSW 19 34587627 missense probably benign 0.06
R6523:Ifit3 UTSW 19 34588155 missense probably benign 0.10
R7535:Ifit3 UTSW 19 34587880 missense probably damaging 0.98
R7947:Ifit3 UTSW 19 34587959 nonsense probably null
R8049:Ifit3 UTSW 19 34588080 missense possibly damaging 0.88
R8142:Ifit3 UTSW 19 34587501 missense probably damaging 1.00
R8850:Ifit3 UTSW 19 34587588 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTCATGACTCCGACACCC -3'
(R):5'- GATTGATCATTGTGCTCTGACTTC -3'

Sequencing Primer
(F):5'- TTTGTGGGTGCTCATCAC -3'
(R):5'- CTTAAATCTTCAGCTTGCCCTAAG -3'
Posted On 2018-06-06