Incidental Mutation 'R6560:Bbs5'
ID521978
Institutional Source Beutler Lab
Gene Symbol Bbs5
Ensembl Gene ENSMUSG00000063145
Gene NameBardet-Biedl syndrome 5 (human)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6560 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location69647171-69667571 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69656956 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 194 (N194K)
Ref Sequence ENSEMBL: ENSMUSP00000107905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074963] [ENSMUST00000112286] [ENSMUST00000134659]
Predicted Effect probably damaging
Transcript: ENSMUST00000074963
AA Change: N194K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074494
Gene: ENSMUSG00000063145
AA Change: N194K

DomainStartEndE-ValueType
Pfam:DUF1448 7 339 6.2e-161 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112286
AA Change: N194K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107905
Gene: ENSMUSG00000063145
AA Change: N194K

DomainStartEndE-ValueType
Pfam:DUF1448 6 208 1.6e-100 PFAM
Pfam:DUF1448 206 319 9.9e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127806
SMART Domains Protein: ENSMUSP00000121691
Gene: ENSMUSG00000063145

DomainStartEndE-ValueType
Pfam:DUF1448 22 90 9.9e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130061
Predicted Effect probably benign
Transcript: ENSMUST00000134659
SMART Domains Protein: ENSMUSP00000119377
Gene: ENSMUSG00000063145

DomainStartEndE-ValueType
Pfam:DUF1448 6 88 3.1e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144240
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has been directly linked to Bardet-Biedl syndrome. The primary features of this syndrome include retinal dystrophy, obesity, polydactyly, renal abnormalities and learning disabilities. Experimentation in non-human eukaryotes suggests that this gene is expressed in ciliated cells and that it is required for the formation of cilia. Alternate transcriptional splice variants have been observed but have not been fully characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 80,007,396 L1235Q probably damaging Het
Acin1 T C 14: 54,678,833 T174A probably benign Het
Adamtsl1 G A 4: 86,336,893 R733H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Arsk A T 13: 76,074,986 I164N probably benign Het
Bicra T C 7: 15,989,194 T133A possibly damaging Het
Card6 G A 15: 5,098,885 P1010S probably damaging Het
Ccdc18 T A 5: 108,191,924 N778K probably benign Het
Cept1 T C 3: 106,505,278 I240V possibly damaging Het
Crip3 A G 17: 46,431,036 R150G probably damaging Het
Cyp2c50 A G 19: 40,096,855 T320A probably benign Het
Dio2 G C 12: 90,729,833 S127* probably null Het
Dscam T C 16: 96,825,735 S325G probably benign Het
Exosc4 A G 15: 76,327,613 I41V probably benign Het
Glb1l3 C T 9: 26,828,424 probably null Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm3072 T A 14: 41,623,553 D89V unknown Het
Gosr2 T C 11: 103,686,682 H79R probably damaging Het
Has2 T A 15: 56,668,264 T352S probably damaging Het
Insig1 T A 5: 28,071,533 C32* probably null Het
Klf9 A G 19: 23,141,950 S66G probably damaging Het
Mfn1 T C 3: 32,569,516 I263T probably damaging Het
Myl2 G A 5: 122,102,771 G38R probably null Het
Negr1 A G 3: 157,312,857 T332A probably benign Het
Neo1 A G 9: 58,880,601 S1417P possibly damaging Het
Olfr599 T C 7: 103,338,738 F228S probably benign Het
Olfr859 G A 9: 19,809,116 S266N probably benign Het
Pcgf3 C A 5: 108,473,902 H35Q probably damaging Het
Plppr5 A G 3: 117,671,990 I297V probably benign Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Prx A T 7: 27,515,321 Q85H probably damaging Het
Tex14 T G 11: 87,497,862 M305R possibly damaging Het
Wdr63 T C 3: 146,095,406 E99G possibly damaging Het
Ythdc1 T C 5: 86,816,608 V92A probably benign Het
Zfp619 G A 7: 39,537,530 E995K probably damaging Het
Zfp90 A G 8: 106,415,747 R4G probably damaging Het
Other mutations in Bbs5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01693:Bbs5 APN 2 69663080 missense probably benign
IGL01695:Bbs5 APN 2 69649090 missense probably damaging 1.00
IGL02232:Bbs5 APN 2 69655551 missense probably benign 0.37
IGL02418:Bbs5 APN 2 69655505 makesense probably null
IGL03280:Bbs5 APN 2 69666971 splice site probably benign
R4801:Bbs5 UTSW 2 69655614 missense probably damaging 1.00
R4802:Bbs5 UTSW 2 69655614 missense probably damaging 1.00
R4974:Bbs5 UTSW 2 69647234 start gained probably benign
R6936:Bbs5 UTSW 2 69654354 missense probably damaging 0.99
R7048:Bbs5 UTSW 2 69654361 missense probably benign 0.44
Z1177:Bbs5 UTSW 2 69665071 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GGAAACAAAGACTATTGCTTCTCAG -3'
(R):5'- CAGAACCAACATTTTGAAACTATGC -3'

Sequencing Primer
(F):5'- CAGCCTTTTTGCTAAGTTCAAGTG -3'
(R):5'- TCATCAGATTGGGTTGCAAGCAC -3'
Posted On2018-06-06