Mutagenetix > Incidental Mutations

Incidental Mutation 'R6560:Gm10801'

521980

Institutional Source

Beutler Lab

Gene Symbol

Gm10801

Ensembl Gene

ENSMUSG00000075015

Gene Name

predicted gene 10801

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.440) question?

Stock #

R6560 (G1)

Quality Score

141.467

Status

Not validated

Chromosome

Chromosomal Location

98662237-98664083 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to CGTG at 98663807 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000097276 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099683] [ENSMUST00000099684]

Predicted Effect

probably benign
Transcript: ENSMUST00000099683

SMART Domains

Protein: ENSMUSP00000097275
Gene: ENSMUSG00000075014

Domain	Start	End	E-Value	Type
internal_repeat_1	1	41	1.13e-5	PROSPERO
internal_repeat_2	26	49	4.11e-5	PROSPERO
transmembrane domain	78	96	N/A	INTRINSIC
internal_repeat_1	114	174	1.13e-5	PROSPERO
low complexity region	177	188	N/A	INTRINSIC
internal_repeat_2	197	219	4.11e-5	PROSPERO

Predicted Effect

probably null
Transcript: ENSMUST00000099684

SMART Domains

Protein: ENSMUSP00000097276
Gene: ENSMUSG00000075015

Domain	Start	End	E-Value	Type
internal_repeat_1	2	73	1.19e-13	PROSPERO
internal_repeat_1	80	167	1.19e-13	PROSPERO

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca7	T	A	10: 80,007,396	L1235Q	probably damaging	Het
Acin1	T	C	14: 54,678,833	T174A	probably benign	Het
Adamtsl1	G	A	4: 86,336,893	R733H	probably damaging	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Arsk	A	T	13: 76,074,986	I164N	probably benign	Het
Bbs5	T	A	2: 69,656,956	N194K	probably damaging	Het
Bicra	T	C	7: 15,989,194	T133A	possibly damaging	Het
Card6	G	A	15: 5,098,885	P1010S	probably damaging	Het
Ccdc18	T	A	5: 108,191,924	N778K	probably benign	Het
Cept1	T	C	3: 106,505,278	I240V	possibly damaging	Het
Crip3	A	G	17: 46,431,036	R150G	probably damaging	Het
Cyp2c50	A	G	19: 40,096,855	T320A	probably benign	Het
Dio2	G	C	12: 90,729,833	S127*	probably null	Het
Dscam	T	C	16: 96,825,735	S325G	probably benign	Het
Exosc4	A	G	15: 76,327,613	I41V	probably benign	Het
Glb1l3	C	T	9: 26,828,424		probably null	Het
Gm3072	T	A	14: 41,623,553	D89V	unknown	Het
Gosr2	T	C	11: 103,686,682	H79R	probably damaging	Het
Has2	T	A	15: 56,668,264	T352S	probably damaging	Het
Insig1	T	A	5: 28,071,533	C32*	probably null	Het
Klf9	A	G	19: 23,141,950	S66G	probably damaging	Het
Mfn1	T	C	3: 32,569,516	I263T	probably damaging	Het
Myl2	G	A	5: 122,102,771	G38R	probably null	Het
Negr1	A	G	3: 157,312,857	T332A	probably benign	Het
Neo1	A	G	9: 58,880,601	S1417P	possibly damaging	Het
Olfr599	T	C	7: 103,338,738	F228S	probably benign	Het
Olfr859	G	A	9: 19,809,116	S266N	probably benign	Het
Pcgf3	C	A	5: 108,473,902	H35Q	probably damaging	Het
Plppr5	A	G	3: 117,671,990	I297V	probably benign	Het
Plxna4	C	T	6: 32,215,678	V783M	probably damaging	Het
Prx	A	T	7: 27,515,321	Q85H	probably damaging	Het
Tex14	T	G	11: 87,497,862	M305R	possibly damaging	Het
Wdr63	T	C	3: 146,095,406	E99G	possibly damaging	Het
Ythdc1	T	C	5: 86,816,608	V92A	probably benign	Het
Zfp619	G	A	7: 39,537,530	E995K	probably damaging	Het
Zfp90	A	G	8: 106,415,747	R4G	probably damaging	Het

Other mutations in Gm10801

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01100:Gm10801	APN	2	98663983	missense	probably benign
IGL01154:Gm10801	APN	2	98663983	missense	probably benign
PIT4131001:Gm10801	UTSW	2	98662303	missense	probably benign
PIT4142001:Gm10801	UTSW	2	98662303	missense	probably benign
R0026:Gm10801	UTSW	2	98663909	splice site	probably benign
R0063:Gm10801	UTSW	2	98663840	missense	probably benign	0.30
R0334:Gm10801	UTSW	2	98664007	missense	possibly damaging	0.66
R0335:Gm10801	UTSW	2	98664007	missense	possibly damaging	0.66
R1172:Gm10801	UTSW	2	98663907	splice site	probably benign
R1321:Gm10801	UTSW	2	98663907	splice site	probably benign
R1871:Gm10801	UTSW	2	98663840	missense	probably benign	0.30
R1924:Gm10801	UTSW	2	98663852	missense	probably damaging	1.00
R2163:Gm10801	UTSW	2	98664007	missense	possibly damaging	0.66
R2306:Gm10801	UTSW	2	98664007	missense	possibly damaging	0.66
R2379:Gm10801	UTSW	2	98663840	missense	probably benign	0.30
R3078:Gm10801	UTSW	2	98663852	missense	probably damaging	1.00
R3605:Gm10801	UTSW	2	98664007	missense	possibly damaging	0.66
R3892:Gm10801	UTSW	2	98663901	splice site	probably null
R3930:Gm10801	UTSW	2	98664016	missense	possibly damaging	0.48
R4638:Gm10801	UTSW	2	98664007	missense	possibly damaging	0.66
R4709:Gm10801	UTSW	2	98663901	splice site	probably null
R5390:Gm10801	UTSW	2	98663806	small insertion	probably benign
R5405:Gm10801	UTSW	2	98663806	small insertion	probably benign
R5535:Gm10801	UTSW	2	98662499	frame shift	probably null
R5653:Gm10801	UTSW	2	98664051	missense	probably damaging	1.00
R5747:Gm10801	UTSW	2	98664007	missense	possibly damaging	0.66
R5987:Gm10801	UTSW	2	98663807	nonsense	probably null
R6086:Gm10801	UTSW	2	98663803	nonsense	probably null
R6090:Gm10801	UTSW	2	98663806	small insertion	probably benign
R6093:Gm10801	UTSW	2	98663807	nonsense	probably null
R6112:Gm10801	UTSW	2	98664064	missense	probably benign	0.00
R6184:Gm10801	UTSW	2	98663806	small insertion	probably benign
R6352:Gm10801	UTSW	2	98663806	small insertion	probably benign
R6357:Gm10801	UTSW	2	98663807	frame shift	probably null
R6395:Gm10801	UTSW	2	98663807	small insertion	probably benign
R6514:Gm10801	UTSW	2	98663869	missense	probably benign	0.19
R6547:Gm10801	UTSW	2	98663803	nonsense	probably null
R6640:Gm10801	UTSW	2	98663807	nonsense	probably null
R6675:Gm10801	UTSW	2	98663806	small insertion	probably benign
R6679:Gm10801	UTSW	2	98663806	small insertion	probably benign
R6684:Gm10801	UTSW	2	98663807	nonsense	probably null
R6758:Gm10801	UTSW	2	98663807	nonsense	probably null
R6786:Gm10801	UTSW	2	98663803	nonsense	probably null
R6886:Gm10801	UTSW	2	98663806	small insertion	probably benign
R7783:Gm10801	UTSW	2	98663807	nonsense	probably null
R8032:Gm10801	UTSW	2	98663807	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CATCTGTGTAGAAAGCTGTTGCTC -3'
(R):5'- ACTTTCTCTAGCCCCGGAAAC -3'

Sequencing Primer
(F):5'- TGGCTCAATGGCAGAGTGC -3'
(R):5'- ATGCACACTGTAAGACCTGG -3'

Posted On

2018-06-06