Incidental Mutation 'R6560:Cept1'
ID521984
Institutional Source Beutler Lab
Gene Symbol Cept1
Ensembl Gene ENSMUSG00000040774
Gene Namecholine/ethanolaminephosphotransferase 1
Synonyms9930118K05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock #R6560 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location106502260-106547802 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106505278 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 240 (I240V)
Ref Sequence ENSEMBL: ENSMUSP00000142097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029508] [ENSMUST00000039153] [ENSMUST00000068301] [ENSMUST00000121231] [ENSMUST00000183271] [ENSMUST00000192438]
Predicted Effect probably benign
Transcript: ENSMUST00000029508
SMART Domains Protein: ENSMUSP00000029508
Gene: ENSMUSG00000027901

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
uDENN 47 139 4.15e-27 SMART
DENN 146 330 8.1e-71 SMART
dDENN 368 435 3.38e-18 SMART
low complexity region 447 461 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000039153
AA Change: I293V

PolyPhen 2 Score 0.497 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000037277
Gene: ENSMUSG00000040774
AA Change: I293V

DomainStartEndE-ValueType
Pfam:CDP-OH_P_transf 81 229 6.4e-23 PFAM
transmembrane domain 249 271 N/A INTRINSIC
transmembrane domain 281 303 N/A INTRINSIC
transmembrane domain 316 338 N/A INTRINSIC
transmembrane domain 370 389 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000068301
AA Change: I293V

PolyPhen 2 Score 0.497 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000065743
Gene: ENSMUSG00000040774
AA Change: I293V

DomainStartEndE-ValueType
Pfam:CDP-OH_P_transf 81 328 3.2e-21 PFAM
transmembrane domain 370 389 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121231
AA Change: I293V

PolyPhen 2 Score 0.497 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112509
Gene: ENSMUSG00000040774
AA Change: I293V

DomainStartEndE-ValueType
Pfam:CDP-OH_P_transf 83 158 7.4e-18 PFAM
transmembrane domain 181 203 N/A INTRINSIC
transmembrane domain 213 235 N/A INTRINSIC
transmembrane domain 248 270 N/A INTRINSIC
transmembrane domain 285 304 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
transmembrane domain 370 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183271
SMART Domains Protein: ENSMUSP00000138462
Gene: ENSMUSG00000027901

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
uDENN 57 149 4.15e-27 SMART
DENN 156 340 8.1e-71 SMART
dDENN 378 445 3.38e-18 SMART
low complexity region 457 471 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000192438
AA Change: I240V

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142097
Gene: ENSMUSG00000040774
AA Change: I240V

DomainStartEndE-ValueType
Pfam:CDP-OH_P_transf 81 215 2.3e-20 PFAM
transmembrane domain 227 246 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene codes for a choline/ethanolaminephosphotransferase, which functions in the synthesis of choline- or ethanolamine- containing phospholipids. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Conditional homozygous knockout in skeletal muscle leads to improved glucose tolerance, increased insulin sensitivity and muscle weakness in mice fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 80,007,396 L1235Q probably damaging Het
Acin1 T C 14: 54,678,833 T174A probably benign Het
Adamtsl1 G A 4: 86,336,893 R733H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Arsk A T 13: 76,074,986 I164N probably benign Het
Bbs5 T A 2: 69,656,956 N194K probably damaging Het
Bicra T C 7: 15,989,194 T133A possibly damaging Het
Card6 G A 15: 5,098,885 P1010S probably damaging Het
Ccdc18 T A 5: 108,191,924 N778K probably benign Het
Crip3 A G 17: 46,431,036 R150G probably damaging Het
Cyp2c50 A G 19: 40,096,855 T320A probably benign Het
Dio2 G C 12: 90,729,833 S127* probably null Het
Dscam T C 16: 96,825,735 S325G probably benign Het
Exosc4 A G 15: 76,327,613 I41V probably benign Het
Glb1l3 C T 9: 26,828,424 probably null Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm3072 T A 14: 41,623,553 D89V unknown Het
Gosr2 T C 11: 103,686,682 H79R probably damaging Het
Has2 T A 15: 56,668,264 T352S probably damaging Het
Insig1 T A 5: 28,071,533 C32* probably null Het
Klf9 A G 19: 23,141,950 S66G probably damaging Het
Mfn1 T C 3: 32,569,516 I263T probably damaging Het
Myl2 G A 5: 122,102,771 G38R probably null Het
Negr1 A G 3: 157,312,857 T332A probably benign Het
Neo1 A G 9: 58,880,601 S1417P possibly damaging Het
Olfr599 T C 7: 103,338,738 F228S probably benign Het
Olfr859 G A 9: 19,809,116 S266N probably benign Het
Pcgf3 C A 5: 108,473,902 H35Q probably damaging Het
Plppr5 A G 3: 117,671,990 I297V probably benign Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Prx A T 7: 27,515,321 Q85H probably damaging Het
Tex14 T G 11: 87,497,862 M305R possibly damaging Het
Wdr63 T C 3: 146,095,406 E99G possibly damaging Het
Ythdc1 T C 5: 86,816,608 V92A probably benign Het
Zfp619 G A 7: 39,537,530 E995K probably damaging Het
Zfp90 A G 8: 106,415,747 R4G probably damaging Het
Other mutations in Cept1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Cept1 APN 3 106505803 missense possibly damaging 0.95
IGL01860:Cept1 APN 3 106531128 intron probably benign
IGL02053:Cept1 APN 3 106533396 missense probably damaging 1.00
IGL02351:Cept1 APN 3 106539188 critical splice donor site probably null
IGL02358:Cept1 APN 3 106539188 critical splice donor site probably null
IGL02568:Cept1 APN 3 106503719 missense probably benign 0.03
IGL02960:Cept1 APN 3 106539396 nonsense probably null
IGL03019:Cept1 APN 3 106504641 missense probably damaging 1.00
IGL03182:Cept1 APN 3 106504550 missense probably damaging 1.00
IGL03401:Cept1 APN 3 106533390 missense probably damaging 1.00
R2128:Cept1 UTSW 3 106512879 missense probably damaging 1.00
R2928:Cept1 UTSW 3 106531152 missense probably benign 0.07
R3688:Cept1 UTSW 3 106520015 missense probably benign 0.00
R4762:Cept1 UTSW 3 106539361 nonsense probably null
R4861:Cept1 UTSW 3 106505732 missense probably damaging 0.97
R4861:Cept1 UTSW 3 106505732 missense probably damaging 0.97
R4890:Cept1 UTSW 3 106505807 missense probably damaging 1.00
R5506:Cept1 UTSW 3 106531248 missense probably benign 0.00
R5999:Cept1 UTSW 3 106533443 missense probably damaging 1.00
R6106:Cept1 UTSW 3 106503676 missense probably benign 0.00
R6478:Cept1 UTSW 3 106533445 nonsense probably null
R6858:Cept1 UTSW 3 106512879 splice site probably null
R7372:Cept1 UTSW 3 106503740 missense probably benign 0.14
R8481:Cept1 UTSW 3 106505253 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGACTACTTAGGAAGCCACAC -3'
(R):5'- CCAAGCACAGAACTGTTTGTGTC -3'

Sequencing Primer
(F):5'- TTAGGAAGCCACACAATGAAATTCAG -3'
(R):5'- GTGTGTCTGACAGCACTA -3'
Posted On2018-06-06