Incidental Mutation 'R6560:Plppr5'
ID521986
Institutional Source Beutler Lab
Gene Symbol Plppr5
Ensembl Gene ENSMUSG00000033342
Gene Namephospholipid phosphatase related 5
Synonyms4833424O15Rik, Lppr5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6560 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location117574836-117689507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117671990 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 297 (I297V)
Ref Sequence ENSEMBL: ENSMUSP00000102081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039564] [ENSMUST00000106473]
Predicted Effect probably benign
Transcript: ENSMUST00000039564
AA Change: I297V

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000045121
Gene: ENSMUSG00000033342
AA Change: I297V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
acidPPc 123 267 8.27e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106473
AA Change: I297V

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000102081
Gene: ENSMUSG00000033342
AA Change: I297V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
acidPPc 123 267 8.27e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type 2 member of the phosphatidic acid phosphatase (PAP) family. All type 2 members of this protein family contain 6 transmembrane regions, and a consensus N-glycosylation site. PAPs convert phosphatidic acid to diacylglycerol, and function in de novo synthesis of glycerolipids as well as in receptor-activated signal transduction mediated by phospholipase D. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 80,007,396 L1235Q probably damaging Het
Acin1 T C 14: 54,678,833 T174A probably benign Het
Adamtsl1 G A 4: 86,336,893 R733H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Arsk A T 13: 76,074,986 I164N probably benign Het
Bbs5 T A 2: 69,656,956 N194K probably damaging Het
Bicra T C 7: 15,989,194 T133A possibly damaging Het
Card6 G A 15: 5,098,885 P1010S probably damaging Het
Ccdc18 T A 5: 108,191,924 N778K probably benign Het
Cept1 T C 3: 106,505,278 I240V possibly damaging Het
Crip3 A G 17: 46,431,036 R150G probably damaging Het
Cyp2c50 A G 19: 40,096,855 T320A probably benign Het
Dio2 G C 12: 90,729,833 S127* probably null Het
Dscam T C 16: 96,825,735 S325G probably benign Het
Exosc4 A G 15: 76,327,613 I41V probably benign Het
Glb1l3 C T 9: 26,828,424 probably null Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm3072 T A 14: 41,623,553 D89V unknown Het
Gosr2 T C 11: 103,686,682 H79R probably damaging Het
Has2 T A 15: 56,668,264 T352S probably damaging Het
Insig1 T A 5: 28,071,533 C32* probably null Het
Klf9 A G 19: 23,141,950 S66G probably damaging Het
Mfn1 T C 3: 32,569,516 I263T probably damaging Het
Myl2 G A 5: 122,102,771 G38R probably null Het
Negr1 A G 3: 157,312,857 T332A probably benign Het
Neo1 A G 9: 58,880,601 S1417P possibly damaging Het
Olfr599 T C 7: 103,338,738 F228S probably benign Het
Olfr859 G A 9: 19,809,116 S266N probably benign Het
Pcgf3 C A 5: 108,473,902 H35Q probably damaging Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Prx A T 7: 27,515,321 Q85H probably damaging Het
Tex14 T G 11: 87,497,862 M305R possibly damaging Het
Wdr63 T C 3: 146,095,406 E99G possibly damaging Het
Ythdc1 T C 5: 86,816,608 V92A probably benign Het
Zfp619 G A 7: 39,537,530 E995K probably damaging Het
Zfp90 A G 8: 106,415,747 R4G probably damaging Het
Other mutations in Plppr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Plppr5 APN 3 117671943 missense possibly damaging 0.46
IGL01081:Plppr5 APN 3 117686649 utr 3 prime probably benign
IGL01315:Plppr5 APN 3 117662526 missense probably damaging 1.00
IGL02802:Plppr5 UTSW 3 117662579 missense probably damaging 1.00
R0044:Plppr5 UTSW 3 117671889 splice site probably null
R0044:Plppr5 UTSW 3 117671889 splice site probably null
R0332:Plppr5 UTSW 3 117671932 missense probably benign 0.05
R0757:Plppr5 UTSW 3 117575891 missense probably benign 0.16
R1101:Plppr5 UTSW 3 117662523 missense probably damaging 0.99
R1354:Plppr5 UTSW 3 117575847 missense possibly damaging 0.94
R1498:Plppr5 UTSW 3 117662612 missense probably damaging 0.97
R1967:Plppr5 UTSW 3 117625906 critical splice donor site probably null
R2090:Plppr5 UTSW 3 117575871 missense possibly damaging 0.63
R4661:Plppr5 UTSW 3 117620969 missense probably damaging 1.00
R5143:Plppr5 UTSW 3 117625903 missense probably benign
R5441:Plppr5 UTSW 3 117662471 missense possibly damaging 0.94
R5722:Plppr5 UTSW 3 117621065 missense probably benign 0.00
R7221:Plppr5 UTSW 3 117620969 missense probably damaging 1.00
Z1177:Plppr5 UTSW 3 117625779 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATGGTAAGTCTGCGTGTAAAG -3'
(R):5'- GCTACCTGACACCTTAAATTCTGAG -3'

Sequencing Primer
(F):5'- AGTCTGCGTGTAAAGTTTTATTCATG -3'
(R):5'- ACTGGTCACTCTCGGAAT -3'
Posted On2018-06-06