Mutagenetix > Incidental Mutations

Incidental Mutation 'R6560:Negr1'

521990

Institutional Source

Beutler Lab

Gene Symbol

Negr1

Ensembl Gene

ENSMUSG00000040037

Gene Name

neuronal growth regulator 1

Synonyms

Ntra, 5330422G01Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6560 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

156561794-157316445 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 157312857 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 332 (T332A)

Ref Sequence

ENSEMBL: ENSMUSP00000073664 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074015]

Predicted Effect

probably benign
Transcript: ENSMUST00000074015
AA Change: T332A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000073664
Gene: ENSMUSG00000040037
AA Change: T332A

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
IG	39	130	2.52e-9	SMART
IGc2	145	204	3.22e-16	SMART
IGc2	230	298	3.82e-9	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out or ENU-induced allele exhibit reduced body weight. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca7	T	A	10: 80,007,396	L1235Q	probably damaging	Het
Acin1	T	C	14: 54,678,833	T174A	probably benign	Het
Adamtsl1	G	A	4: 86,336,893	R733H	probably damaging	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Arsk	A	T	13: 76,074,986	I164N	probably benign	Het
Bbs5	T	A	2: 69,656,956	N194K	probably damaging	Het
Bicra	T	C	7: 15,989,194	T133A	possibly damaging	Het
Card6	G	A	15: 5,098,885	P1010S	probably damaging	Het
Ccdc18	T	A	5: 108,191,924	N778K	probably benign	Het
Cept1	T	C	3: 106,505,278	I240V	possibly damaging	Het
Crip3	A	G	17: 46,431,036	R150G	probably damaging	Het
Cyp2c50	A	G	19: 40,096,855	T320A	probably benign	Het
Dio2	G	C	12: 90,729,833	S127*	probably null	Het
Dscam	T	C	16: 96,825,735	S325G	probably benign	Het
Exosc4	A	G	15: 76,327,613	I41V	probably benign	Het
Glb1l3	C	T	9: 26,828,424		probably null	Het
Gm10801	C	CGTG	2: 98,663,807		probably null	Het
Gm3072	T	A	14: 41,623,553	D89V	unknown	Het
Gosr2	T	C	11: 103,686,682	H79R	probably damaging	Het
Has2	T	A	15: 56,668,264	T352S	probably damaging	Het
Insig1	T	A	5: 28,071,533	C32*	probably null	Het
Klf9	A	G	19: 23,141,950	S66G	probably damaging	Het
Mfn1	T	C	3: 32,569,516	I263T	probably damaging	Het
Myl2	G	A	5: 122,102,771	G38R	probably null	Het
Neo1	A	G	9: 58,880,601	S1417P	possibly damaging	Het
Olfr599	T	C	7: 103,338,738	F228S	probably benign	Het
Olfr859	G	A	9: 19,809,116	S266N	probably benign	Het
Pcgf3	C	A	5: 108,473,902	H35Q	probably damaging	Het
Plppr5	A	G	3: 117,671,990	I297V	probably benign	Het
Plxna4	C	T	6: 32,215,678	V783M	probably damaging	Het
Prx	A	T	7: 27,515,321	Q85H	probably damaging	Het
Tex14	T	G	11: 87,497,862	M305R	possibly damaging	Het
Wdr63	T	C	3: 146,095,406	E99G	possibly damaging	Het
Ythdc1	T	C	5: 86,816,608	V92A	probably benign	Het
Zfp619	G	A	7: 39,537,530	E995K	probably damaging	Het
Zfp90	A	G	8: 106,415,747	R4G	probably damaging	Het

Other mutations in Negr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01284:Negr1	APN	3	157146217	missense	probably damaging	1.00
IGL01635:Negr1	APN	3	156562292	missense	probably benign	0.00
IGL02006:Negr1	APN	3	157016173	splice site	probably benign
IGL02427:Negr1	APN	3	156562190	start gained	probably benign
IGL02542:Negr1	APN	3	156562225	missense	probably damaging	1.00
PIT4466001:Negr1	UTSW	3	156859598	missense	probably benign	0.44
R0241:Negr1	UTSW	3	157208399	intron	probably benign
R0496:Negr1	UTSW	3	157016267	missense	probably damaging	1.00
R0506:Negr1	UTSW	3	157160748	splice site	probably benign
R0507:Negr1	UTSW	3	156562225	missense	probably damaging	0.97
R0634:Negr1	UTSW	3	157016266	missense	possibly damaging	0.51
R1324:Negr1	UTSW	3	157069223	missense	probably damaging	1.00
R1923:Negr1	UTSW	3	156562199	missense	probably benign	0.06
R4569:Negr1	UTSW	3	157208376	intron	probably benign
R4592:Negr1	UTSW	3	157208386	intron	probably benign
R4874:Negr1	UTSW	3	156859445	missense	probably damaging	0.98
R5137:Negr1	UTSW	3	157016196	missense	probably damaging	0.99
R5330:Negr1	UTSW	3	157069276	nonsense	probably null
R5331:Negr1	UTSW	3	157069276	nonsense	probably null
R5974:Negr1	UTSW	3	157069286	missense	probably damaging	1.00
R7506:Negr1	UTSW	3	157069233	nonsense	probably null
R7677:Negr1	UTSW	3	157069186	nonsense	probably null
R8080:Negr1	UTSW	3	157160720	missense	probably damaging	1.00
R8523:Negr1	UTSW	3	157160660	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGGCTAACCATTTCTGCCC -3'
(R):5'- GTCGTGTGTCTAATCAAAAGGAGAG -3'

Sequencing Primer
(F):5'- AACCATTTCTGCCCCCAGC -3'
(R):5'- GTATTTACACAACCAGCGATTCC -3'

Posted On

2018-06-06