Incidental Mutation 'R6560:Negr1'
ID521990
Institutional Source Beutler Lab
Gene Symbol Negr1
Ensembl Gene ENSMUSG00000040037
Gene Nameneuronal growth regulator 1
SynonymsNtra, 5330422G01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6560 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location156561794-157316445 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 157312857 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 332 (T332A)
Ref Sequence ENSEMBL: ENSMUSP00000073664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074015]
Predicted Effect probably benign
Transcript: ENSMUST00000074015
AA Change: T332A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073664
Gene: ENSMUSG00000040037
AA Change: T332A

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IG 39 130 2.52e-9 SMART
IGc2 145 204 3.22e-16 SMART
IGc2 230 298 3.82e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out or ENU-induced allele exhibit reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 80,007,396 L1235Q probably damaging Het
Acin1 T C 14: 54,678,833 T174A probably benign Het
Adamtsl1 G A 4: 86,336,893 R733H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Arsk A T 13: 76,074,986 I164N probably benign Het
Bbs5 T A 2: 69,656,956 N194K probably damaging Het
Bicra T C 7: 15,989,194 T133A possibly damaging Het
Card6 G A 15: 5,098,885 P1010S probably damaging Het
Ccdc18 T A 5: 108,191,924 N778K probably benign Het
Cept1 T C 3: 106,505,278 I240V possibly damaging Het
Crip3 A G 17: 46,431,036 R150G probably damaging Het
Cyp2c50 A G 19: 40,096,855 T320A probably benign Het
Dio2 G C 12: 90,729,833 S127* probably null Het
Dscam T C 16: 96,825,735 S325G probably benign Het
Exosc4 A G 15: 76,327,613 I41V probably benign Het
Glb1l3 C T 9: 26,828,424 probably null Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm3072 T A 14: 41,623,553 D89V unknown Het
Gosr2 T C 11: 103,686,682 H79R probably damaging Het
Has2 T A 15: 56,668,264 T352S probably damaging Het
Insig1 T A 5: 28,071,533 C32* probably null Het
Klf9 A G 19: 23,141,950 S66G probably damaging Het
Mfn1 T C 3: 32,569,516 I263T probably damaging Het
Myl2 G A 5: 122,102,771 G38R probably null Het
Neo1 A G 9: 58,880,601 S1417P possibly damaging Het
Olfr599 T C 7: 103,338,738 F228S probably benign Het
Olfr859 G A 9: 19,809,116 S266N probably benign Het
Pcgf3 C A 5: 108,473,902 H35Q probably damaging Het
Plppr5 A G 3: 117,671,990 I297V probably benign Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Prx A T 7: 27,515,321 Q85H probably damaging Het
Tex14 T G 11: 87,497,862 M305R possibly damaging Het
Wdr63 T C 3: 146,095,406 E99G possibly damaging Het
Ythdc1 T C 5: 86,816,608 V92A probably benign Het
Zfp619 G A 7: 39,537,530 E995K probably damaging Het
Zfp90 A G 8: 106,415,747 R4G probably damaging Het
Other mutations in Negr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Negr1 APN 3 157146217 missense probably damaging 1.00
IGL01635:Negr1 APN 3 156562292 missense probably benign 0.00
IGL02006:Negr1 APN 3 157016173 splice site probably benign
IGL02427:Negr1 APN 3 156562190 start gained probably benign
IGL02542:Negr1 APN 3 156562225 missense probably damaging 1.00
PIT4466001:Negr1 UTSW 3 156859598 missense probably benign 0.44
R0241:Negr1 UTSW 3 157208399 intron probably benign
R0496:Negr1 UTSW 3 157016267 missense probably damaging 1.00
R0506:Negr1 UTSW 3 157160748 splice site probably benign
R0507:Negr1 UTSW 3 156562225 missense probably damaging 0.97
R0634:Negr1 UTSW 3 157016266 missense possibly damaging 0.51
R1324:Negr1 UTSW 3 157069223 missense probably damaging 1.00
R1923:Negr1 UTSW 3 156562199 missense probably benign 0.06
R4569:Negr1 UTSW 3 157208376 intron probably benign
R4592:Negr1 UTSW 3 157208386 intron probably benign
R4874:Negr1 UTSW 3 156859445 missense probably damaging 0.98
R5137:Negr1 UTSW 3 157016196 missense probably damaging 0.99
R5330:Negr1 UTSW 3 157069276 nonsense probably null
R5331:Negr1 UTSW 3 157069276 nonsense probably null
R5974:Negr1 UTSW 3 157069286 missense probably damaging 1.00
R7506:Negr1 UTSW 3 157069233 nonsense probably null
R7677:Negr1 UTSW 3 157069186 nonsense probably null
R8080:Negr1 UTSW 3 157160720 missense probably damaging 1.00
R8523:Negr1 UTSW 3 157160660 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGGCTAACCATTTCTGCCC -3'
(R):5'- GTCGTGTGTCTAATCAAAAGGAGAG -3'

Sequencing Primer
(F):5'- AACCATTTCTGCCCCCAGC -3'
(R):5'- GTATTTACACAACCAGCGATTCC -3'
Posted On2018-06-06