Incidental Mutation 'R6560:Insig1'
ID521994
Institutional Source Beutler Lab
Gene Symbol Insig1
Ensembl Gene ENSMUSG00000045294
Gene Nameinsulin induced gene 1
Synonyms1810013C12Rik, Insig-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.475) question?
Stock #R6560 (G1)
Quality Score96.0077
Status Not validated
Chromosome5
Chromosomal Location28071363-28078662 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 28071533 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 32 (C32*)
Ref Sequence ENSEMBL: ENSMUSP00000061877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059155]
Predicted Effect probably null
Transcript: ENSMUST00000059155
AA Change: C32*
SMART Domains Protein: ENSMUSP00000061877
Gene: ENSMUSG00000045294
AA Change: C32*

DomainStartEndE-ValueType
Pfam:INSIG 68 249 1.1e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180740
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199728
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum membrane protein that regulates cholesterol metabolism, lipogenesis, and glucose homeostasis. The encoded protein has six transmembrane helices which contain an effector protein binding site. It binds the sterol-sensing domains of sterol regulatory element-binding protein (SREBP) cleavage-activating protein (SCAP) and 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMG-CoA reductase), and is essential for the sterol-mediated trafficking of these two proteins. It promotes the endoplasmic reticulum retention of SCAP and the ubiquitin-mediated degradation of HMG-CoA reductase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body body weight, increased gonadal and subcutaneous fat pad, decreased circulating triglyceride level and abnormal adipocity differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 80,007,396 L1235Q probably damaging Het
Acin1 T C 14: 54,678,833 T174A probably benign Het
Adamtsl1 G A 4: 86,336,893 R733H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Arsk A T 13: 76,074,986 I164N probably benign Het
Bbs5 T A 2: 69,656,956 N194K probably damaging Het
Bicra T C 7: 15,989,194 T133A possibly damaging Het
Card6 G A 15: 5,098,885 P1010S probably damaging Het
Ccdc18 T A 5: 108,191,924 N778K probably benign Het
Cept1 T C 3: 106,505,278 I240V possibly damaging Het
Crip3 A G 17: 46,431,036 R150G probably damaging Het
Cyp2c50 A G 19: 40,096,855 T320A probably benign Het
Dio2 G C 12: 90,729,833 S127* probably null Het
Dscam T C 16: 96,825,735 S325G probably benign Het
Exosc4 A G 15: 76,327,613 I41V probably benign Het
Glb1l3 C T 9: 26,828,424 probably null Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm3072 T A 14: 41,623,553 D89V unknown Het
Gosr2 T C 11: 103,686,682 H79R probably damaging Het
Has2 T A 15: 56,668,264 T352S probably damaging Het
Klf9 A G 19: 23,141,950 S66G probably damaging Het
Mfn1 T C 3: 32,569,516 I263T probably damaging Het
Myl2 G A 5: 122,102,771 G38R probably null Het
Negr1 A G 3: 157,312,857 T332A probably benign Het
Neo1 A G 9: 58,880,601 S1417P possibly damaging Het
Olfr599 T C 7: 103,338,738 F228S probably benign Het
Olfr859 G A 9: 19,809,116 S266N probably benign Het
Pcgf3 C A 5: 108,473,902 H35Q probably damaging Het
Plppr5 A G 3: 117,671,990 I297V probably benign Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Prx A T 7: 27,515,321 Q85H probably damaging Het
Tex14 T G 11: 87,497,862 M305R possibly damaging Het
Wdr63 T C 3: 146,095,406 E99G possibly damaging Het
Ythdc1 T C 5: 86,816,608 V92A probably benign Het
Zfp619 G A 7: 39,537,530 E995K probably damaging Het
Zfp90 A G 8: 106,415,747 R4G probably damaging Het
Other mutations in Insig1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1607:Insig1 UTSW 5 28071708 missense probably damaging 1.00
R2006:Insig1 UTSW 5 28071466 missense probably benign
R3738:Insig1 UTSW 5 28071703 missense probably damaging 0.99
R5604:Insig1 UTSW 5 28075082 missense probably damaging 1.00
R7429:Insig1 UTSW 5 28075079 missense probably damaging 1.00
R8534:Insig1 UTSW 5 28075118 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGCCTTATAAGCGGAAACC -3'
(R):5'- TAACAGCTGACGTGTCCCTTC -3'

Sequencing Primer
(F):5'- TGTACCTTCCATGCTGTG -3'
(R):5'- TGACATTCCGCTGGATCTGCAG -3'
Posted On2018-06-06