Incidental Mutation 'R6560:Ythdc1'
ID521996
Institutional Source Beutler Lab
Gene Symbol Ythdc1
Ensembl Gene ENSMUSG00000035851
Gene NameYTH domain containing 1
SynonymsA730098D12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R6560 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location86804221-86836659 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86816608 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 92 (V92A)
Ref Sequence ENSEMBL: ENSMUSP00000113951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038384] [ENSMUST00000119339] [ENSMUST00000120498] [ENSMUST00000156363]
Predicted Effect probably benign
Transcript: ENSMUST00000038384
AA Change: V92A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000039133
Gene: ENSMUSG00000035851
AA Change: V92A

DomainStartEndE-ValueType
SCOP:d1qbkb_ 225 249 6e-3 SMART
low complexity region 269 280 N/A INTRINSIC
low complexity region 316 330 N/A INTRINSIC
Pfam:YTH 356 494 5e-42 PFAM
low complexity region 516 540 N/A INTRINSIC
low complexity region 609 622 N/A INTRINSIC
low complexity region 625 645 N/A INTRINSIC
low complexity region 682 736 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119339
AA Change: V92A

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113000
Gene: ENSMUSG00000035851
AA Change: V92A

DomainStartEndE-ValueType
SCOP:d1qbkb_ 225 249 6e-3 SMART
low complexity region 269 280 N/A INTRINSIC
Pfam:YTH 337 478 4.4e-44 PFAM
low complexity region 498 522 N/A INTRINSIC
low complexity region 583 596 N/A INTRINSIC
low complexity region 599 619 N/A INTRINSIC
low complexity region 656 710 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120498
AA Change: V92A

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113951
Gene: ENSMUSG00000035851
AA Change: V92A

DomainStartEndE-ValueType
SCOP:d1qbkb_ 225 249 6e-3 SMART
low complexity region 269 280 N/A INTRINSIC
low complexity region 316 330 N/A INTRINSIC
Pfam:YTH 355 496 4.6e-44 PFAM
low complexity region 516 540 N/A INTRINSIC
low complexity region 601 614 N/A INTRINSIC
low complexity region 617 637 N/A INTRINSIC
low complexity region 674 728 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151489
Predicted Effect probably benign
Transcript: ENSMUST00000156363
AA Change: V104A

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000122491
Gene: ENSMUSG00000035851
AA Change: V104A

DomainStartEndE-ValueType
SCOP:d1qbkb_ 237 261 8e-3 SMART
low complexity region 281 292 N/A INTRINSIC
Pfam:YTH 350 488 3e-42 PFAM
low complexity region 510 525 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198859
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 80,007,396 L1235Q probably damaging Het
Acin1 T C 14: 54,678,833 T174A probably benign Het
Adamtsl1 G A 4: 86,336,893 R733H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Arsk A T 13: 76,074,986 I164N probably benign Het
Bbs5 T A 2: 69,656,956 N194K probably damaging Het
Bicra T C 7: 15,989,194 T133A possibly damaging Het
Card6 G A 15: 5,098,885 P1010S probably damaging Het
Ccdc18 T A 5: 108,191,924 N778K probably benign Het
Cept1 T C 3: 106,505,278 I240V possibly damaging Het
Crip3 A G 17: 46,431,036 R150G probably damaging Het
Cyp2c50 A G 19: 40,096,855 T320A probably benign Het
Dio2 G C 12: 90,729,833 S127* probably null Het
Dscam T C 16: 96,825,735 S325G probably benign Het
Exosc4 A G 15: 76,327,613 I41V probably benign Het
Glb1l3 C T 9: 26,828,424 probably null Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm3072 T A 14: 41,623,553 D89V unknown Het
Gosr2 T C 11: 103,686,682 H79R probably damaging Het
Has2 T A 15: 56,668,264 T352S probably damaging Het
Insig1 T A 5: 28,071,533 C32* probably null Het
Klf9 A G 19: 23,141,950 S66G probably damaging Het
Mfn1 T C 3: 32,569,516 I263T probably damaging Het
Myl2 G A 5: 122,102,771 G38R probably null Het
Negr1 A G 3: 157,312,857 T332A probably benign Het
Neo1 A G 9: 58,880,601 S1417P possibly damaging Het
Olfr599 T C 7: 103,338,738 F228S probably benign Het
Olfr859 G A 9: 19,809,116 S266N probably benign Het
Pcgf3 C A 5: 108,473,902 H35Q probably damaging Het
Plppr5 A G 3: 117,671,990 I297V probably benign Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Prx A T 7: 27,515,321 Q85H probably damaging Het
Tex14 T G 11: 87,497,862 M305R possibly damaging Het
Wdr63 T C 3: 146,095,406 E99G possibly damaging Het
Zfp619 G A 7: 39,537,530 E995K probably damaging Het
Zfp90 A G 8: 106,415,747 R4G probably damaging Het
Other mutations in Ythdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00676:Ythdc1 APN 5 86831811 missense probably damaging 1.00
IGL02222:Ythdc1 APN 5 86828043 missense possibly damaging 0.72
R0091:Ythdc1 UTSW 5 86820701 intron probably benign
R0311:Ythdc1 UTSW 5 86835705 missense probably damaging 0.97
R0349:Ythdc1 UTSW 5 86835720 missense probably damaging 1.00
R0630:Ythdc1 UTSW 5 86809348 splice site probably benign
R1662:Ythdc1 UTSW 5 86828122 critical splice donor site probably null
R1907:Ythdc1 UTSW 5 86830630 missense probably damaging 1.00
R2100:Ythdc1 UTSW 5 86816685 missense possibly damaging 0.62
R2911:Ythdc1 UTSW 5 86816559 missense possibly damaging 0.95
R3692:Ythdc1 UTSW 5 86822667 missense probably damaging 0.98
R4042:Ythdc1 UTSW 5 86816524 missense probably benign 0.03
R4398:Ythdc1 UTSW 5 86815654 missense possibly damaging 0.95
R4398:Ythdc1 UTSW 5 86835820 utr 3 prime probably benign
R4608:Ythdc1 UTSW 5 86822808 missense probably damaging 0.97
R4806:Ythdc1 UTSW 5 86822845 missense probably damaging 0.99
R5291:Ythdc1 UTSW 5 86835688 missense probably damaging 1.00
R5761:Ythdc1 UTSW 5 86835951 utr 3 prime probably benign
R6180:Ythdc1 UTSW 5 86828094 missense possibly damaging 0.91
R6249:Ythdc1 UTSW 5 86831956 missense possibly damaging 0.94
R7145:Ythdc1 UTSW 5 86816608 missense probably benign 0.06
R8072:Ythdc1 UTSW 5 86821274 nonsense probably null
R8225:Ythdc1 UTSW 5 86816937 missense possibly damaging 0.91
R8225:Ythdc1 UTSW 5 86816938 missense possibly damaging 0.73
R8229:Ythdc1 UTSW 5 86809308 intron probably benign
R8246:Ythdc1 UTSW 5 86817322 missense possibly damaging 0.94
R8284:Ythdc1 UTSW 5 86816466 missense probably benign 0.18
R8385:Ythdc1 UTSW 5 86828102 missense possibly damaging 0.77
R8546:Ythdc1 UTSW 5 86826748 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- GTTCAGCAGTTGGGAAGCAG -3'
(R):5'- TGTAGGAGACTTGGCCCTTC -3'

Sequencing Primer
(F):5'- CAGCAGTTGGGAAGCAGTTTTG -3'
(R):5'- AGGAGACTTGGCCCTTCTTTCAG -3'
Posted On2018-06-06