Mutagenetix > Incidental Mutation

Incidental Mutation 'R6560:Ccdc18'

521998

Institutional Source

Beutler Lab

Gene Symbol

Ccdc18

Ensembl Gene

ENSMUSG00000056531

Gene Name

coiled-coil domain containing 18

Synonyms

4932411G06Rik, 1700021E15Rik

MMRRC Submission

044684-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6560 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

108132875-108233628 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 108191924 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 778 (N778K)

Ref Sequence

ENSEMBL: ENSMUSP00000036507 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047677]

AlphaFold

Q640L5

Predicted Effect

probably benign
Transcript: ENSMUST00000047677
AA Change: N778K

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000036507
Gene: ENSMUSG00000056531
AA Change: N778K

Domain	Start	End	E-Value	Type
coiled coil region	109	140	N/A	INTRINSIC
coiled coil region	168	320	N/A	INTRINSIC
coiled coil region	344	405	N/A	INTRINSIC
coiled coil region	507	1307	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca7	T	A	10: 80,007,396	L1235Q	probably damaging	Het
Acin1	T	C	14: 54,678,833	T174A	probably benign	Het
Adamtsl1	G	A	4: 86,336,893	R733H	probably damaging	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Arsk	A	T	13: 76,074,986	I164N	probably benign	Het
Bbs5	T	A	2: 69,656,956	N194K	probably damaging	Het
Bicra	T	C	7: 15,989,194	T133A	possibly damaging	Het
Card6	G	A	15: 5,098,885	P1010S	probably damaging	Het
Cept1	T	C	3: 106,505,278	I240V	possibly damaging	Het
Crip3	A	G	17: 46,431,036	R150G	probably damaging	Het
Cyp2c50	A	G	19: 40,096,855	T320A	probably benign	Het
Dio2	G	C	12: 90,729,833	S127*	probably null	Het
Dscam	T	C	16: 96,825,735	S325G	probably benign	Het
Exosc4	A	G	15: 76,327,613	I41V	probably benign	Het
Glb1l3	C	T	9: 26,828,424		probably null	Het
Gm10801	C	CGTG	2: 98,663,807		probably null	Het
Gm3072	T	A	14: 41,623,553	D89V	unknown	Het
Gosr2	T	C	11: 103,686,682	H79R	probably damaging	Het
Has2	T	A	15: 56,668,264	T352S	probably damaging	Het
Insig1	T	A	5: 28,071,533	C32*	probably null	Het
Klf9	A	G	19: 23,141,950	S66G	probably damaging	Het
Mfn1	T	C	3: 32,569,516	I263T	probably damaging	Het
Myl2	G	A	5: 122,102,771	G38R	probably null	Het
Negr1	A	G	3: 157,312,857	T332A	probably benign	Het
Neo1	A	G	9: 58,880,601	S1417P	possibly damaging	Het
Olfr599	T	C	7: 103,338,738	F228S	probably benign	Het
Olfr859	G	A	9: 19,809,116	S266N	probably benign	Het
Pcgf3	C	A	5: 108,473,902	H35Q	probably damaging	Het
Plppr5	A	G	3: 117,671,990	I297V	probably benign	Het
Plxna4	C	T	6: 32,215,678	V783M	probably damaging	Het
Prx	A	T	7: 27,515,321	Q85H	probably damaging	Het
Tex14	T	G	11: 87,497,862	M305R	possibly damaging	Het
Wdr63	T	C	3: 146,095,406	E99G	possibly damaging	Het
Ythdc1	T	C	5: 86,816,608	V92A	probably benign	Het
Zfp619	G	A	7: 39,537,530	E995K	probably damaging	Het
Zfp90	A	G	8: 106,415,747	R4G	probably damaging	Het

Other mutations in Ccdc18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00836:Ccdc18	APN	5	108180525	missense	probably benign	0.01
IGL01380:Ccdc18	APN	5	108180887	missense	probably damaging	0.96
IGL01405:Ccdc18	APN	5	108202186	splice site	probably benign
IGL01718:Ccdc18	APN	5	108201348	missense	possibly damaging	0.81
IGL02098:Ccdc18	APN	5	108202111	missense	probably damaging	1.00
IGL02227:Ccdc18	APN	5	108148922	missense	possibly damaging	0.89
IGL02391:Ccdc18	APN	5	108136052	missense	probably damaging	1.00
IGL02794:Ccdc18	APN	5	108171748	missense	probably benign	0.00
IGL02808:Ccdc18	APN	5	108135969	splice site	probably benign
IGL02880:Ccdc18	APN	5	108135444	missense	probably benign	0.31
IGL03069:Ccdc18	APN	5	108228901	missense	probably damaging	1.00
IGL03390:Ccdc18	APN	5	108212131	missense	probably damaging	1.00
PIT4402001:Ccdc18	UTSW	5	108158619	missense	possibly damaging	0.94
R0004:Ccdc18	UTSW	5	108161700	missense	possibly damaging	0.52
R0112:Ccdc18	UTSW	5	108173761	missense	probably damaging	1.00
R0295:Ccdc18	UTSW	5	108173789	missense	probably damaging	1.00
R0546:Ccdc18	UTSW	5	108174964	missense	probably benign	0.06
R0619:Ccdc18	UTSW	5	108180416	missense	probably benign	0.04
R0648:Ccdc18	UTSW	5	108135560	missense	probably damaging	0.99
R0648:Ccdc18	UTSW	5	108174987	missense	probably damaging	1.00
R0666:Ccdc18	UTSW	5	108163664	missense	probably benign	0.19
R1271:Ccdc18	UTSW	5	108202116	nonsense	probably null
R1509:Ccdc18	UTSW	5	108188978	missense	possibly damaging	0.89
R1539:Ccdc18	UTSW	5	108191977	missense	probably damaging	1.00
R1542:Ccdc18	UTSW	5	108212188	missense	probably benign
R1663:Ccdc18	UTSW	5	108216090	missense	probably damaging	1.00
R1865:Ccdc18	UTSW	5	108193802	missense	probably benign	0.00
R1870:Ccdc18	UTSW	5	108220837	missense	possibly damaging	0.90
R1897:Ccdc18	UTSW	5	108196042	missense	probably benign	0.00
R1946:Ccdc18	UTSW	5	108228995	missense	probably damaging	1.00
R2420:Ccdc18	UTSW	5	108228588	missense	probably damaging	0.96
R2421:Ccdc18	UTSW	5	108228588	missense	probably damaging	0.96
R2422:Ccdc18	UTSW	5	108228588	missense	probably damaging	0.96
R4078:Ccdc18	UTSW	5	108158528	nonsense	probably null
R4079:Ccdc18	UTSW	5	108158528	nonsense	probably null
R4244:Ccdc18	UTSW	5	108148972	nonsense	probably null
R4409:Ccdc18	UTSW	5	108220842	nonsense	probably null
R4428:Ccdc18	UTSW	5	108136077	missense	probably benign	0.01
R4455:Ccdc18	UTSW	5	108161529	missense	possibly damaging	0.68
R4499:Ccdc18	UTSW	5	108228960	missense	possibly damaging	0.62
R4612:Ccdc18	UTSW	5	108135441	missense	probably benign	0.01
R4907:Ccdc18	UTSW	5	108136141	missense	probably benign	0.01
R4972:Ccdc18	UTSW	5	108192003	missense	probably benign
R5039:Ccdc18	UTSW	5	108158648	critical splice donor site	probably null
R5835:Ccdc18	UTSW	5	108140874	missense	possibly damaging	0.94
R5854:Ccdc18	UTSW	5	108206728	missense	possibly damaging	0.79
R6128:Ccdc18	UTSW	5	108163759	missense	possibly damaging	0.76
R6229:Ccdc18	UTSW	5	108171618	missense	probably benign	0.00
R6271:Ccdc18	UTSW	5	108174887	missense	possibly damaging	0.65
R6315:Ccdc18	UTSW	5	108161582	missense	probably benign
R6359:Ccdc18	UTSW	5	108135525	missense	probably damaging	1.00
R6375:Ccdc18	UTSW	5	108174954	missense	possibly damaging	0.79
R6388:Ccdc18	UTSW	5	108201348	missense	possibly damaging	0.81
R6415:Ccdc18	UTSW	5	108161746	missense	probably benign	0.03
R6645:Ccdc18	UTSW	5	108138930	missense	probably benign
R6664:Ccdc18	UTSW	5	108168100	nonsense	probably null
R6836:Ccdc18	UTSW	5	108197967	missense	probably damaging	1.00
R6947:Ccdc18	UTSW	5	108161535	missense	probably benign	0.26
R7009:Ccdc18	UTSW	5	108173862	critical splice donor site	probably null
R7052:Ccdc18	UTSW	5	108161688	missense	probably benign	0.15
R7058:Ccdc18	UTSW	5	108193798	missense	probably benign
R7087:Ccdc18	UTSW	5	108196122	missense	probably benign
R7117:Ccdc18	UTSW	5	108148969	missense	possibly damaging	0.95
R7176:Ccdc18	UTSW	5	108168106	missense	probably benign
R7382:Ccdc18	UTSW	5	108139007	missense	probably damaging	1.00
R7477:Ccdc18	UTSW	5	108220850	missense	probably damaging	0.98
R7493:Ccdc18	UTSW	5	108206617	nonsense	probably null
R7506:Ccdc18	UTSW	5	108163739	missense	possibly damaging	0.85
R7635:Ccdc18	UTSW	5	108229049	critical splice donor site	probably null
R7690:Ccdc18	UTSW	5	108228662	missense	probably benign	0.00
R7748:Ccdc18	UTSW	5	108149041	critical splice donor site	probably null
R7812:Ccdc18	UTSW	5	108180833	missense	probably benign	0.00
R8017:Ccdc18	UTSW	5	108228645	nonsense	probably null
R8019:Ccdc18	UTSW	5	108228645	nonsense	probably null
R8172:Ccdc18	UTSW	5	108163774	critical splice donor site	probably null
R8177:Ccdc18	UTSW	5	108197795	missense	possibly damaging	0.65
R8344:Ccdc18	UTSW	5	108161503	missense	possibly damaging	0.88
R8351:Ccdc18	UTSW	5	108155797	missense	probably damaging	1.00
R8415:Ccdc18	UTSW	5	108216033	missense	probably damaging	1.00
R8451:Ccdc18	UTSW	5	108155797	missense	probably damaging	1.00
R8547:Ccdc18	UTSW	5	108197859	missense	probably damaging	1.00
R8725:Ccdc18	UTSW	5	108180417	missense	possibly damaging	0.66
R9137:Ccdc18	UTSW	5	108148990	missense	probably damaging	0.98
R9391:Ccdc18	UTSW	5	108228904	missense	probably benign	0.02
R9418:Ccdc18	UTSW	5	108155803	missense	probably damaging	1.00
R9536:Ccdc18	UTSW	5	108138926	missense	probably benign	0.01
R9565:Ccdc18	UTSW	5	108191934	missense	probably damaging	0.99
RF013:Ccdc18	UTSW	5	108220716	missense	probably benign	0.05
X0024:Ccdc18	UTSW	5	108191922	missense	probably benign	0.01
X0063:Ccdc18	UTSW	5	108212197	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCAGAATTATGAACCCTGCCC -3'
(R):5'- CTGACCTTGGTAGTAAGTGGTC -3'

Sequencing Primer
(F):5'- AGAATTATGAACCCTGCCCTTCTC -3'
(R):5'- AGTGGTCTAGGTCTGATTACATAAG -3'

Posted On

2018-06-06