Incidental Mutation 'R6560:Myl2'
ID522002
Institutional Source Beutler Lab
Gene Symbol Myl2
Ensembl Gene ENSMUSG00000013936
Gene Namemyosin, light polypeptide 2, regulatory, cardiac, slow
SynonymsMlc2v, MLC-2v, MLC-2, Mylpc
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6560 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location122100951-122113472 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 122102771 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 38 (G38R)
Ref Sequence ENSEMBL: ENSMUSP00000120274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014080] [ENSMUST00000111750] [ENSMUST00000111751] [ENSMUST00000139213] [ENSMUST00000146733] [ENSMUST00000150535] [ENSMUST00000155612]
Predicted Effect probably null
Transcript: ENSMUST00000014080
AA Change: G57R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014080
Gene: ENSMUSG00000013936
AA Change: G57R

DomainStartEndE-ValueType
EFh 28 56 2.81e-5 SMART
EFh 98 126 4.53e0 SMART
EFh 134 162 3.97e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111750
AA Change: G57R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107379
Gene: ENSMUSG00000013936
AA Change: G57R

DomainStartEndE-ValueType
EFh 28 56 2.81e-5 SMART
EFh 98 126 4.53e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111751
AA Change: G57R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107380
Gene: ENSMUSG00000013936
AA Change: G57R

DomainStartEndE-ValueType
EFh 28 56 2.81e-5 SMART
EFh 98 126 4.53e0 SMART
EFh 134 162 3.97e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123913
Predicted Effect probably benign
Transcript: ENSMUST00000126006
SMART Domains Protein: ENSMUSP00000123261
Gene: ENSMUSG00000013936

DomainStartEndE-ValueType
PDB:2W4H|B 2 62 4e-8 PDB
SCOP:d1wdcb_ 10 62 4e-5 SMART
Blast:EFh 37 62 3e-11 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000139213
AA Change: G38R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114156
Gene: ENSMUSG00000013936
AA Change: G38R

DomainStartEndE-ValueType
Pfam:EF-hand_7 6 54 7e-8 PFAM
Pfam:EF-hand_1 9 37 6.4e-8 PFAM
Pfam:EF-hand_6 9 40 6.2e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000146733
AA Change: G38R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142592
Gene: ENSMUSG00000013936
AA Change: G38R

DomainStartEndE-ValueType
Pfam:EF-hand_7 6 54 1.2e-6 PFAM
Pfam:EF-hand_1 9 37 1.1e-6 PFAM
Pfam:EF-hand_6 9 40 1.1e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147178
Predicted Effect probably null
Transcript: ENSMUST00000150535
AA Change: G38R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120274
Gene: ENSMUSG00000013936
AA Change: G38R

DomainStartEndE-ValueType
Pfam:EF-hand_7 6 54 6.2e-8 PFAM
Pfam:EF-hand_1 9 37 5.8e-8 PFAM
Pfam:EF-hand_6 9 40 5.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152744
Predicted Effect probably null
Transcript: ENSMUST00000153816
AA Change: G90R
SMART Domains Protein: ENSMUSP00000119627
Gene: ENSMUSG00000013936
AA Change: G90R

DomainStartEndE-ValueType
Pfam:EF-hand_1 62 90 2.4e-8 PFAM
Pfam:EF-hand_6 62 91 7.5e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000155612
AA Change: G38R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120105
Gene: ENSMUSG00000013936
AA Change: G38R

DomainStartEndE-ValueType
EFh 9 37 2.81e-5 SMART
EFh 79 107 4.53e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Thus gene encodes the regulatory light chain associated with cardiac myosin beta (or slow) heavy chain. Ca+ triggers the phosphorylation of regulatory light chain that in turn triggers contraction. Mutations in this gene are associated with mid-left ventricular chamber type hypertrophic cardiomyopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for a knock-in allele exhibit embryonic growth retardation and die between E12.5 and E14.5 with abnormal heart development characterized by a single ventricle, complete absence of the interventricular groove and septum, and a thin myocardium compact layer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 80,007,396 L1235Q probably damaging Het
Acin1 T C 14: 54,678,833 T174A probably benign Het
Adamtsl1 G A 4: 86,336,893 R733H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Arsk A T 13: 76,074,986 I164N probably benign Het
Bbs5 T A 2: 69,656,956 N194K probably damaging Het
Bicra T C 7: 15,989,194 T133A possibly damaging Het
Card6 G A 15: 5,098,885 P1010S probably damaging Het
Ccdc18 T A 5: 108,191,924 N778K probably benign Het
Cept1 T C 3: 106,505,278 I240V possibly damaging Het
Crip3 A G 17: 46,431,036 R150G probably damaging Het
Cyp2c50 A G 19: 40,096,855 T320A probably benign Het
Dio2 G C 12: 90,729,833 S127* probably null Het
Dscam T C 16: 96,825,735 S325G probably benign Het
Exosc4 A G 15: 76,327,613 I41V probably benign Het
Glb1l3 C T 9: 26,828,424 probably null Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm3072 T A 14: 41,623,553 D89V unknown Het
Gosr2 T C 11: 103,686,682 H79R probably damaging Het
Has2 T A 15: 56,668,264 T352S probably damaging Het
Insig1 T A 5: 28,071,533 C32* probably null Het
Klf9 A G 19: 23,141,950 S66G probably damaging Het
Mfn1 T C 3: 32,569,516 I263T probably damaging Het
Negr1 A G 3: 157,312,857 T332A probably benign Het
Neo1 A G 9: 58,880,601 S1417P possibly damaging Het
Olfr599 T C 7: 103,338,738 F228S probably benign Het
Olfr859 G A 9: 19,809,116 S266N probably benign Het
Pcgf3 C A 5: 108,473,902 H35Q probably damaging Het
Plppr5 A G 3: 117,671,990 I297V probably benign Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Prx A T 7: 27,515,321 Q85H probably damaging Het
Tex14 T G 11: 87,497,862 M305R possibly damaging Het
Wdr63 T C 3: 146,095,406 E99G possibly damaging Het
Ythdc1 T C 5: 86,816,608 V92A probably benign Het
Zfp619 G A 7: 39,537,530 E995K probably damaging Het
Zfp90 A G 8: 106,415,747 R4G probably damaging Het
Other mutations in Myl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Myl2 APN 5 122106704 missense probably benign
R2879:Myl2 UTSW 5 122104685 critical splice donor site probably null
R4580:Myl2 UTSW 5 122106738 missense probably benign 0.37
R5569:Myl2 UTSW 5 122106720 missense possibly damaging 0.95
R5782:Myl2 UTSW 5 122104870 missense probably damaging 1.00
R6493:Myl2 UTSW 5 122106728 missense possibly damaging 0.64
R6878:Myl2 UTSW 5 122105077 missense probably benign
R7163:Myl2 UTSW 5 122101822 missense probably damaging 1.00
R7374:Myl2 UTSW 5 122101663 missense
R7951:Myl2 UTSW 5 122106687 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCAGGTCACCAGGTTTTACTC -3'
(R):5'- AGTGTAGCCTTCTGGGTAATTC -3'

Sequencing Primer
(F):5'- AGGTTTTACTCCTGCCATGTC -3'
(R):5'- TCGGCAGATAACAAATGGG -3'
Posted On2018-06-06