Mutagenetix > Incidental Mutations

Incidental Mutation 'R6560:Myl2'

522002

Institutional Source

Beutler Lab

Gene Symbol

Myl2

Ensembl Gene

ENSMUSG00000013936

Gene Name

myosin, light polypeptide 2, regulatory, cardiac, slow

Synonyms

Mlc2v, MLC-2v, MLC-2, Mylpc

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6560 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

122100951-122113472 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 122102771 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 38 (G38R)

Ref Sequence

ENSEMBL: ENSMUSP00000120274 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014080] [ENSMUST00000111750] [ENSMUST00000111751] [ENSMUST00000139213] [ENSMUST00000146733] [ENSMUST00000150535] [ENSMUST00000155612]

Predicted Effect

probably null
Transcript: ENSMUST00000014080
AA Change: G57R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000014080
Gene: ENSMUSG00000013936
AA Change: G57R

Domain	Start	End	E-Value	Type
EFh	28	56	2.81e-5	SMART
EFh	98	126	4.53e0	SMART
EFh	134	162	3.97e1	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000111750
AA Change: G57R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107379
Gene: ENSMUSG00000013936
AA Change: G57R

Domain	Start	End	E-Value	Type
EFh	28	56	2.81e-5	SMART
EFh	98	126	4.53e0	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000111751
AA Change: G57R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107380
Gene: ENSMUSG00000013936
AA Change: G57R

Domain	Start	End	E-Value	Type
EFh	28	56	2.81e-5	SMART
EFh	98	126	4.53e0	SMART
EFh	134	162	3.97e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123913

Predicted Effect

probably benign
Transcript: ENSMUST00000126006

SMART Domains

Protein: ENSMUSP00000123261
Gene: ENSMUSG00000013936

Domain	Start	End	E-Value	Type
PDB:2W4H\|B	2	62	4e-8	PDB
SCOP:d1wdcb_	10	62	4e-5	SMART
Blast:EFh	37	62	3e-11	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000139213
AA Change: G38R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114156
Gene: ENSMUSG00000013936
AA Change: G38R

Domain	Start	End	E-Value	Type
Pfam:EF-hand_7	6	54	7e-8	PFAM
Pfam:EF-hand_1	9	37	6.4e-8	PFAM
Pfam:EF-hand_6	9	40	6.2e-8	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000146733
AA Change: G38R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000142592
Gene: ENSMUSG00000013936
AA Change: G38R

Domain	Start	End	E-Value	Type
Pfam:EF-hand_7	6	54	1.2e-6	PFAM
Pfam:EF-hand_1	9	37	1.1e-6	PFAM
Pfam:EF-hand_6	9	40	1.1e-6	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147178

Predicted Effect

probably null
Transcript: ENSMUST00000150535
AA Change: G38R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000120274
Gene: ENSMUSG00000013936
AA Change: G38R

Domain	Start	End	E-Value	Type
Pfam:EF-hand_7	6	54	6.2e-8	PFAM
Pfam:EF-hand_1	9	37	5.8e-8	PFAM
Pfam:EF-hand_6	9	40	5.6e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152744

Predicted Effect

probably null
Transcript: ENSMUST00000153816
AA Change: G90R

SMART Domains

Protein: ENSMUSP00000119627
Gene: ENSMUSG00000013936
AA Change: G90R

Domain	Start	End	E-Value	Type
Pfam:EF-hand_1	62	90	2.4e-8	PFAM
Pfam:EF-hand_6	62	91	7.5e-9	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000155612
AA Change: G38R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000120105
Gene: ENSMUSG00000013936
AA Change: G38R

Domain	Start	End	E-Value	Type
EFh	9	37	2.81e-5	SMART
EFh	79	107	4.53e0	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Thus gene encodes the regulatory light chain associated with cardiac myosin beta (or slow) heavy chain. Ca+ triggers the phosphorylation of regulatory light chain that in turn triggers contraction. Mutations in this gene are associated with mid-left ventricular chamber type hypertrophic cardiomyopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for a knock-in allele exhibit embryonic growth retardation and die between E12.5 and E14.5 with abnormal heart development characterized by a single ventricle, complete absence of the interventricular groove and septum, and a thin myocardium compact layer. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca7	T	A	10: 80,007,396	L1235Q	probably damaging	Het
Acin1	T	C	14: 54,678,833	T174A	probably benign	Het
Adamtsl1	G	A	4: 86,336,893	R733H	probably damaging	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Arsk	A	T	13: 76,074,986	I164N	probably benign	Het
Bbs5	T	A	2: 69,656,956	N194K	probably damaging	Het
Bicra	T	C	7: 15,989,194	T133A	possibly damaging	Het
Card6	G	A	15: 5,098,885	P1010S	probably damaging	Het
Ccdc18	T	A	5: 108,191,924	N778K	probably benign	Het
Cept1	T	C	3: 106,505,278	I240V	possibly damaging	Het
Crip3	A	G	17: 46,431,036	R150G	probably damaging	Het
Cyp2c50	A	G	19: 40,096,855	T320A	probably benign	Het
Dio2	G	C	12: 90,729,833	S127*	probably null	Het
Dscam	T	C	16: 96,825,735	S325G	probably benign	Het
Exosc4	A	G	15: 76,327,613	I41V	probably benign	Het
Glb1l3	C	T	9: 26,828,424		probably null	Het
Gm10801	C	CGTG	2: 98,663,807		probably null	Het
Gm3072	T	A	14: 41,623,553	D89V	unknown	Het
Gosr2	T	C	11: 103,686,682	H79R	probably damaging	Het
Has2	T	A	15: 56,668,264	T352S	probably damaging	Het
Insig1	T	A	5: 28,071,533	C32*	probably null	Het
Klf9	A	G	19: 23,141,950	S66G	probably damaging	Het
Mfn1	T	C	3: 32,569,516	I263T	probably damaging	Het
Negr1	A	G	3: 157,312,857	T332A	probably benign	Het
Neo1	A	G	9: 58,880,601	S1417P	possibly damaging	Het
Olfr599	T	C	7: 103,338,738	F228S	probably benign	Het
Olfr859	G	A	9: 19,809,116	S266N	probably benign	Het
Pcgf3	C	A	5: 108,473,902	H35Q	probably damaging	Het
Plppr5	A	G	3: 117,671,990	I297V	probably benign	Het
Plxna4	C	T	6: 32,215,678	V783M	probably damaging	Het
Prx	A	T	7: 27,515,321	Q85H	probably damaging	Het
Tex14	T	G	11: 87,497,862	M305R	possibly damaging	Het
Wdr63	T	C	3: 146,095,406	E99G	possibly damaging	Het
Ythdc1	T	C	5: 86,816,608	V92A	probably benign	Het
Zfp619	G	A	7: 39,537,530	E995K	probably damaging	Het
Zfp90	A	G	8: 106,415,747	R4G	probably damaging	Het

Other mutations in Myl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01068:Myl2	APN	5	122106704	missense	probably benign
R2879:Myl2	UTSW	5	122104685	critical splice donor site	probably null
R4580:Myl2	UTSW	5	122106738	missense	probably benign	0.37
R5569:Myl2	UTSW	5	122106720	missense	possibly damaging	0.95
R5782:Myl2	UTSW	5	122104870	missense	probably damaging	1.00
R6493:Myl2	UTSW	5	122106728	missense	possibly damaging	0.64
R6878:Myl2	UTSW	5	122105077	missense	probably benign
R7163:Myl2	UTSW	5	122101822	missense	probably damaging	1.00
R7374:Myl2	UTSW	5	122101663	missense
R7951:Myl2	UTSW	5	122106687	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGCAGGTCACCAGGTTTTACTC -3'
(R):5'- AGTGTAGCCTTCTGGGTAATTC -3'

Sequencing Primer
(F):5'- AGGTTTTACTCCTGCCATGTC -3'
(R):5'- TCGGCAGATAACAAATGGG -3'

Posted On

2018-06-06