Incidental Mutation 'R6560:Bicra'
ID522008
Institutional Source Beutler Lab
Gene Symbol Bicra
Ensembl Gene ENSMUSG00000070808
Gene NameBRD4 interacting chromatin remodeling complex associated protein
SynonymsGltscr1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R6560 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location15970672-16047921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15989194 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 133 (T133A)
Ref Sequence ENSEMBL: ENSMUSP00000148012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094821] [ENSMUST00000210781]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094821
AA Change: T133A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000092416
Gene: ENSMUSG00000070808
AA Change: T133A

DomainStartEndE-ValueType
low complexity region 86 96 N/A INTRINSIC
low complexity region 140 155 N/A INTRINSIC
internal_repeat_1 156 298 1.03e-6 PROSPERO
low complexity region 308 323 N/A INTRINSIC
low complexity region 427 443 N/A INTRINSIC
internal_repeat_1 479 614 1.03e-6 PROSPERO
low complexity region 619 638 N/A INTRINSIC
low complexity region 642 676 N/A INTRINSIC
low complexity region 719 732 N/A INTRINSIC
low complexity region 756 782 N/A INTRINSIC
low complexity region 790 819 N/A INTRINSIC
low complexity region 827 843 N/A INTRINSIC
low complexity region 852 906 N/A INTRINSIC
low complexity region 940 950 N/A INTRINSIC
low complexity region 987 1006 N/A INTRINSIC
Pfam:GLTSCR1 1094 1202 4.6e-43 PFAM
low complexity region 1232 1251 N/A INTRINSIC
low complexity region 1275 1294 N/A INTRINSIC
low complexity region 1349 1371 N/A INTRINSIC
low complexity region 1460 1473 N/A INTRINSIC
low complexity region 1535 1555 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210035
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210713
Predicted Effect possibly damaging
Transcript: ENSMUST00000210781
AA Change: T133A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 80,007,396 L1235Q probably damaging Het
Acin1 T C 14: 54,678,833 T174A probably benign Het
Adamtsl1 G A 4: 86,336,893 R733H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Arsk A T 13: 76,074,986 I164N probably benign Het
Bbs5 T A 2: 69,656,956 N194K probably damaging Het
Card6 G A 15: 5,098,885 P1010S probably damaging Het
Ccdc18 T A 5: 108,191,924 N778K probably benign Het
Cept1 T C 3: 106,505,278 I240V possibly damaging Het
Crip3 A G 17: 46,431,036 R150G probably damaging Het
Cyp2c50 A G 19: 40,096,855 T320A probably benign Het
Dio2 G C 12: 90,729,833 S127* probably null Het
Dscam T C 16: 96,825,735 S325G probably benign Het
Exosc4 A G 15: 76,327,613 I41V probably benign Het
Glb1l3 C T 9: 26,828,424 probably null Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm3072 T A 14: 41,623,553 D89V unknown Het
Gosr2 T C 11: 103,686,682 H79R probably damaging Het
Has2 T A 15: 56,668,264 T352S probably damaging Het
Insig1 T A 5: 28,071,533 C32* probably null Het
Klf9 A G 19: 23,141,950 S66G probably damaging Het
Mfn1 T C 3: 32,569,516 I263T probably damaging Het
Myl2 G A 5: 122,102,771 G38R probably null Het
Negr1 A G 3: 157,312,857 T332A probably benign Het
Neo1 A G 9: 58,880,601 S1417P possibly damaging Het
Olfr599 T C 7: 103,338,738 F228S probably benign Het
Olfr859 G A 9: 19,809,116 S266N probably benign Het
Pcgf3 C A 5: 108,473,902 H35Q probably damaging Het
Plppr5 A G 3: 117,671,990 I297V probably benign Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Prx A T 7: 27,515,321 Q85H probably damaging Het
Tex14 T G 11: 87,497,862 M305R possibly damaging Het
Wdr63 T C 3: 146,095,406 E99G possibly damaging Het
Ythdc1 T C 5: 86,816,608 V92A probably benign Het
Zfp619 G A 7: 39,537,530 E995K probably damaging Het
Zfp90 A G 8: 106,415,747 R4G probably damaging Het
Other mutations in Bicra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Bicra APN 7 15996577 missense possibly damaging 0.70
IGL01521:Bicra APN 7 15989188 missense probably benign 0.18
IGL01690:Bicra APN 7 15987753 missense probably benign 0.09
IGL01721:Bicra APN 7 15988699 missense probably benign
IGL01994:Bicra APN 7 15972816 missense possibly damaging 0.46
IGL02084:Bicra APN 7 15987738 missense probably benign 0.09
IGL02312:Bicra APN 7 15993141 missense possibly damaging 0.85
IGL02686:Bicra APN 7 15987915 missense probably benign 0.02
IGL02727:Bicra APN 7 15979465 missense possibly damaging 0.95
IGL03031:Bicra APN 7 15975801 missense probably benign 0.16
R0003:Bicra UTSW 7 15971887 missense probably benign
R0025:Bicra UTSW 7 15987511 missense possibly damaging 0.53
R0241:Bicra UTSW 7 15975145 missense probably damaging 1.00
R0241:Bicra UTSW 7 15975145 missense probably damaging 1.00
R0417:Bicra UTSW 7 15972322 missense probably damaging 1.00
R0437:Bicra UTSW 7 15988762 missense possibly damaging 0.73
R0547:Bicra UTSW 7 15972248 missense probably damaging 1.00
R0688:Bicra UTSW 7 15989322 missense probably damaging 1.00
R0855:Bicra UTSW 7 15972004 missense probably damaging 1.00
R1448:Bicra UTSW 7 15988359 missense possibly damaging 0.86
R1637:Bicra UTSW 7 15972689 missense probably benign 0.19
R1899:Bicra UTSW 7 15987751 missense possibly damaging 0.53
R2035:Bicra UTSW 7 15996413 missense possibly damaging 0.53
R2247:Bicra UTSW 7 15989234 missense probably benign 0.33
R2471:Bicra UTSW 7 15972332 missense probably benign 0.04
R2484:Bicra UTSW 7 15988680 missense possibly damaging 0.96
R3437:Bicra UTSW 7 15989298 missense possibly damaging 0.85
R3551:Bicra UTSW 7 15979733 missense probably benign 0.33
R4816:Bicra UTSW 7 15988906 missense possibly damaging 0.53
R4901:Bicra UTSW 7 15987601 missense possibly damaging 0.53
R5035:Bicra UTSW 7 15979424 missense possibly damaging 0.90
R5078:Bicra UTSW 7 15975457 missense probably damaging 1.00
R5094:Bicra UTSW 7 15975371 missense probably damaging 1.00
R5195:Bicra UTSW 7 15979953 missense possibly damaging 0.93
R5496:Bicra UTSW 7 15987841 missense probably benign 0.33
R5780:Bicra UTSW 7 15979754 missense possibly damaging 0.96
R6541:Bicra UTSW 7 15979129 missense probably benign 0.00
R6575:Bicra UTSW 7 15979131 missense probably benign 0.25
R6854:Bicra UTSW 7 15988762 missense probably benign 0.18
R6967:Bicra UTSW 7 15972205 missense probably damaging 0.97
R7283:Bicra UTSW 7 15972500 missense probably damaging 1.00
R7454:Bicra UTSW 7 15972134 missense probably benign 0.30
R7462:Bicra UTSW 7 15979135 missense possibly damaging 0.84
R7488:Bicra UTSW 7 15989442 critical splice acceptor site probably null
R7506:Bicra UTSW 7 15988213 missense possibly damaging 0.96
R7534:Bicra UTSW 7 15971935 missense probably damaging 0.98
R7915:Bicra UTSW 7 15988522 missense probably benign
R8063:Bicra UTSW 7 15979044 missense probably benign
R8147:Bicra UTSW 7 15988470 missense possibly damaging 0.93
X0064:Bicra UTSW 7 15975775 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGGGTCACATTGCCCAG -3'
(R):5'- TGGACCTGGACTTCCTAGAAG -3'

Sequencing Primer
(F):5'- ACGCTCAAGGCCTTGTTGAC -3'
(R):5'- CCTGGACTTCCTAGAAGATGATATC -3'
Posted On2018-06-06