Incidental Mutation 'R6560:Olfr599'
ID522013
Institutional Source Beutler Lab
Gene Symbol Olfr599
Ensembl Gene ENSMUSG00000073950
Gene Nameolfactory receptor 599
SynonymsGA_x6K02T2PBJ9-6047402-6048349, MOR23-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R6560 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location103335917-103339564 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103338738 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 228 (F228S)
Ref Sequence ENSEMBL: ENSMUSP00000149281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098201] [ENSMUST00000214329] [ENSMUST00000215042]
Predicted Effect probably benign
Transcript: ENSMUST00000098201
AA Change: F228S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000095803
Gene: ENSMUSG00000073950
AA Change: F228S

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 1.8e-94 PFAM
Pfam:7TM_GPCR_Srsx 37 308 1.2e-6 PFAM
Pfam:7tm_1 43 293 2.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214329
AA Change: F228S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000215042
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 80,007,396 L1235Q probably damaging Het
Acin1 T C 14: 54,678,833 T174A probably benign Het
Adamtsl1 G A 4: 86,336,893 R733H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Arsk A T 13: 76,074,986 I164N probably benign Het
Bbs5 T A 2: 69,656,956 N194K probably damaging Het
Bicra T C 7: 15,989,194 T133A possibly damaging Het
Card6 G A 15: 5,098,885 P1010S probably damaging Het
Ccdc18 T A 5: 108,191,924 N778K probably benign Het
Cept1 T C 3: 106,505,278 I240V possibly damaging Het
Crip3 A G 17: 46,431,036 R150G probably damaging Het
Cyp2c50 A G 19: 40,096,855 T320A probably benign Het
Dio2 G C 12: 90,729,833 S127* probably null Het
Dscam T C 16: 96,825,735 S325G probably benign Het
Exosc4 A G 15: 76,327,613 I41V probably benign Het
Glb1l3 C T 9: 26,828,424 probably null Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm3072 T A 14: 41,623,553 D89V unknown Het
Gosr2 T C 11: 103,686,682 H79R probably damaging Het
Has2 T A 15: 56,668,264 T352S probably damaging Het
Insig1 T A 5: 28,071,533 C32* probably null Het
Klf9 A G 19: 23,141,950 S66G probably damaging Het
Mfn1 T C 3: 32,569,516 I263T probably damaging Het
Myl2 G A 5: 122,102,771 G38R probably null Het
Negr1 A G 3: 157,312,857 T332A probably benign Het
Neo1 A G 9: 58,880,601 S1417P possibly damaging Het
Olfr859 G A 9: 19,809,116 S266N probably benign Het
Pcgf3 C A 5: 108,473,902 H35Q probably damaging Het
Plppr5 A G 3: 117,671,990 I297V probably benign Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Prx A T 7: 27,515,321 Q85H probably damaging Het
Tex14 T G 11: 87,497,862 M305R possibly damaging Het
Wdr63 T C 3: 146,095,406 E99G possibly damaging Het
Ythdc1 T C 5: 86,816,608 V92A probably benign Het
Zfp619 G A 7: 39,537,530 E995K probably damaging Het
Zfp90 A G 8: 106,415,747 R4G probably damaging Het
Other mutations in Olfr599
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Olfr599 APN 7 103338767 nonsense probably null
IGL01744:Olfr599 APN 7 103338228 missense probably damaging 0.98
IGL02011:Olfr599 APN 7 103338849 missense probably damaging 0.98
IGL02328:Olfr599 APN 7 103338290 missense probably damaging 1.00
IGL02630:Olfr599 APN 7 103338429 missense probably damaging 1.00
IGL03119:Olfr599 APN 7 103338722 missense probably damaging 1.00
PIT4468001:Olfr599 UTSW 7 103338600 missense probably damaging 1.00
R0599:Olfr599 UTSW 7 103338186 missense probably damaging 1.00
R4084:Olfr599 UTSW 7 103338320 missense probably damaging 0.99
R5068:Olfr599 UTSW 7 103338022 start gained probably null
R5069:Olfr599 UTSW 7 103338022 start gained probably null
R5280:Olfr599 UTSW 7 103338501 missense probably benign
R5816:Olfr599 UTSW 7 103338995 missense probably benign 0.00
R7001:Olfr599 UTSW 7 103338221 missense possibly damaging 0.51
R7890:Olfr599 UTSW 7 103338330 missense probably benign
R8295:Olfr599 UTSW 7 103338267 missense probably benign 0.08
R8430:Olfr599 UTSW 7 103338957 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCAATGGTTCCACTCTGTTGTG -3'
(R):5'- GGACAACCCATTTGCGGATC -3'

Sequencing Primer
(F):5'- GATTGTTCATTCTTACTGTGAGCAC -3'
(R):5'- TTGGTCTTCACACCATACACAATG -3'
Posted On2018-06-06