Incidental Mutation 'R6560:Olfr859'
ID522018
Institutional Source Beutler Lab
Gene Symbol Olfr859
Ensembl Gene ENSMUSG00000095448
Gene Nameolfactory receptor 859
SynonymsMOR146-3, GA_x6K02T2PVTD-13548326-13549255, MOR146-10_p
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R6560 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location19804906-19817626 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 19809116 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 266 (S266N)
Ref Sequence ENSEMBL: ENSMUSP00000151076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086480] [ENSMUST00000212540] [ENSMUST00000217280]
Predicted Effect probably benign
Transcript: ENSMUST00000086480
AA Change: S266N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000083669
Gene: ENSMUSG00000095448
AA Change: S266N

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.2e-54 PFAM
Pfam:7TM_GPCR_Srsx 35 304 2e-7 PFAM
Pfam:7tm_1 41 290 3.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212540
AA Change: S266N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000217280
AA Change: S266N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 80,007,396 L1235Q probably damaging Het
Acin1 T C 14: 54,678,833 T174A probably benign Het
Adamtsl1 G A 4: 86,336,893 R733H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Arsk A T 13: 76,074,986 I164N probably benign Het
Bbs5 T A 2: 69,656,956 N194K probably damaging Het
Bicra T C 7: 15,989,194 T133A possibly damaging Het
Card6 G A 15: 5,098,885 P1010S probably damaging Het
Ccdc18 T A 5: 108,191,924 N778K probably benign Het
Cept1 T C 3: 106,505,278 I240V possibly damaging Het
Crip3 A G 17: 46,431,036 R150G probably damaging Het
Cyp2c50 A G 19: 40,096,855 T320A probably benign Het
Dio2 G C 12: 90,729,833 S127* probably null Het
Dscam T C 16: 96,825,735 S325G probably benign Het
Exosc4 A G 15: 76,327,613 I41V probably benign Het
Glb1l3 C T 9: 26,828,424 probably null Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm3072 T A 14: 41,623,553 D89V unknown Het
Gosr2 T C 11: 103,686,682 H79R probably damaging Het
Has2 T A 15: 56,668,264 T352S probably damaging Het
Insig1 T A 5: 28,071,533 C32* probably null Het
Klf9 A G 19: 23,141,950 S66G probably damaging Het
Mfn1 T C 3: 32,569,516 I263T probably damaging Het
Myl2 G A 5: 122,102,771 G38R probably null Het
Negr1 A G 3: 157,312,857 T332A probably benign Het
Neo1 A G 9: 58,880,601 S1417P possibly damaging Het
Olfr599 T C 7: 103,338,738 F228S probably benign Het
Pcgf3 C A 5: 108,473,902 H35Q probably damaging Het
Plppr5 A G 3: 117,671,990 I297V probably benign Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Prx A T 7: 27,515,321 Q85H probably damaging Het
Tex14 T G 11: 87,497,862 M305R possibly damaging Het
Wdr63 T C 3: 146,095,406 E99G possibly damaging Het
Ythdc1 T C 5: 86,816,608 V92A probably benign Het
Zfp619 G A 7: 39,537,530 E995K probably damaging Het
Zfp90 A G 8: 106,415,747 R4G probably damaging Het
Other mutations in Olfr859
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Olfr859 APN 9 19808396 missense probably benign 0.09
IGL00897:Olfr859 APN 9 19808621 missense probably damaging 0.97
IGL01132:Olfr859 APN 9 19808654 missense probably damaging 0.97
IGL01768:Olfr859 APN 9 19809160 missense possibly damaging 0.57
IGL02302:Olfr859 APN 9 19808685 missense probably damaging 0.97
IGL02377:Olfr859 APN 9 19809047 missense probably damaging 0.99
IGL02972:Olfr859 APN 9 19808942 missense probably damaging 0.97
R0139:Olfr859 UTSW 9 19808869 missense probably damaging 0.99
R0367:Olfr859 UTSW 9 19808543 missense probably damaging 0.99
R0521:Olfr859 UTSW 9 19808860 missense probably benign 0.00
R1196:Olfr859 UTSW 9 19808632 missense probably benign 0.00
R3742:Olfr859 UTSW 9 19808899 missense probably benign 0.44
R5567:Olfr859 UTSW 9 19808378 missense probably damaging 0.99
R6499:Olfr859 UTSW 9 19808551 missense probably benign
R6501:Olfr859 UTSW 9 19808975 missense possibly damaging 0.95
R7291:Olfr859 UTSW 9 19808648 missense possibly damaging 0.71
R7623:Olfr859 UTSW 9 19808929 missense possibly damaging 0.93
R7627:Olfr859 UTSW 9 19808651 missense probably damaging 0.99
Z1177:Olfr859 UTSW 9 19808534 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCTGTGATGTTCCAGAACTTG -3'
(R):5'- GCCACCACAATTAGTTATGTGAC -3'

Sequencing Primer
(F):5'- CCAGAACTTGTAAAACTTGCTTGTTC -3'
(R):5'- CAGAGGGCTTTCTTGATG -3'
Posted On2018-06-06