Mutagenetix > Incidental Mutations

Incidental Mutation 'R6560:Tex14'

522025

Institutional Source

Beutler Lab

Gene Symbol

Tex14

Ensembl Gene

ENSMUSG00000010342

Gene Name

testis expressed gene 14

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.256) question?

Stock #

R6560 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

87405065-87555823 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 87497862 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Arginine at position 305 (M305R)

Ref Sequence

ENSEMBL: ENSMUSP00000054444 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060835]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000060835
AA Change: M305R

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000054444
Gene: ENSMUSG00000010342
AA Change: M305R

Domain	Start	End	E-Value	Type
ANK	22	51	7.99e2	SMART
ANK	55	84	6.36e-3	SMART
ANK	88	117	3.49e0	SMART
Pfam:Pkinase	251	504	3.5e-19	PFAM
Pfam:Pkinase_Tyr	254	503	8.1e-28	PFAM
coiled coil region	659	684	N/A	INTRINSIC
coiled coil region	740	776	N/A	INTRINSIC
low complexity region	1219	1236	N/A	INTRINSIC
coiled coil region	1289	1309	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is necessary for intercellular bridges in germ cells, which are required for spermatogenesis. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2011]
PHENOTYPE: Males homozygous for a targeted allele are infertile due to spermatogenic failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca7	T	A	10: 80,007,396	L1235Q	probably damaging	Het
Acin1	T	C	14: 54,678,833	T174A	probably benign	Het
Adamtsl1	G	A	4: 86,336,893	R733H	probably damaging	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Arsk	A	T	13: 76,074,986	I164N	probably benign	Het
Bbs5	T	A	2: 69,656,956	N194K	probably damaging	Het
Bicra	T	C	7: 15,989,194	T133A	possibly damaging	Het
Card6	G	A	15: 5,098,885	P1010S	probably damaging	Het
Ccdc18	T	A	5: 108,191,924	N778K	probably benign	Het
Cept1	T	C	3: 106,505,278	I240V	possibly damaging	Het
Crip3	A	G	17: 46,431,036	R150G	probably damaging	Het
Cyp2c50	A	G	19: 40,096,855	T320A	probably benign	Het
Dio2	G	C	12: 90,729,833	S127*	probably null	Het
Dscam	T	C	16: 96,825,735	S325G	probably benign	Het
Exosc4	A	G	15: 76,327,613	I41V	probably benign	Het
Glb1l3	C	T	9: 26,828,424		probably null	Het
Gm10801	C	CGTG	2: 98,663,807		probably null	Het
Gm3072	T	A	14: 41,623,553	D89V	unknown	Het
Gosr2	T	C	11: 103,686,682	H79R	probably damaging	Het
Has2	T	A	15: 56,668,264	T352S	probably damaging	Het
Insig1	T	A	5: 28,071,533	C32*	probably null	Het
Klf9	A	G	19: 23,141,950	S66G	probably damaging	Het
Mfn1	T	C	3: 32,569,516	I263T	probably damaging	Het
Myl2	G	A	5: 122,102,771	G38R	probably null	Het
Negr1	A	G	3: 157,312,857	T332A	probably benign	Het
Neo1	A	G	9: 58,880,601	S1417P	possibly damaging	Het
Olfr599	T	C	7: 103,338,738	F228S	probably benign	Het
Olfr859	G	A	9: 19,809,116	S266N	probably benign	Het
Pcgf3	C	A	5: 108,473,902	H35Q	probably damaging	Het
Plppr5	A	G	3: 117,671,990	I297V	probably benign	Het
Plxna4	C	T	6: 32,215,678	V783M	probably damaging	Het
Prx	A	T	7: 27,515,321	Q85H	probably damaging	Het
Wdr63	T	C	3: 146,095,406	E99G	possibly damaging	Het
Ythdc1	T	C	5: 86,816,608	V92A	probably benign	Het
Zfp619	G	A	7: 39,537,530	E995K	probably damaging	Het
Zfp90	A	G	8: 106,415,747	R4G	probably damaging	Het

Other mutations in Tex14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Tex14	APN	11	87535643	missense	probably damaging	0.98
IGL00494:Tex14	APN	11	87555484	missense	probably damaging	1.00
IGL01604:Tex14	APN	11	87509698	missense	possibly damaging	0.63
IGL02690:Tex14	APN	11	87486274	missense	probably benign	0.11
IGL02888:Tex14	APN	11	87527912	critical splice donor site	probably null
IGL03073:Tex14	APN	11	87535609	missense	probably damaging	0.99
IGL03109:Tex14	APN	11	87543365	missense	probably damaging	1.00
IGL03047:Tex14	UTSW	11	87536704	missense	probably damaging	1.00
R0141:Tex14	UTSW	11	87493031	splice site	probably null
R0455:Tex14	UTSW	11	87514305	missense	possibly damaging	0.93
R0624:Tex14	UTSW	11	87520699	missense	probably benign	0.19
R0718:Tex14	UTSW	11	87499613	missense	probably benign	0.20
R1077:Tex14	UTSW	11	87519745	splice site	probably benign
R1118:Tex14	UTSW	11	87522517	missense	probably benign	0.07
R1120:Tex14	UTSW	11	87538676	splice site	probably benign
R1168:Tex14	UTSW	11	87536742	missense	probably benign	0.11
R1190:Tex14	UTSW	11	87495108	splice site	probably null
R1470:Tex14	UTSW	11	87549529	splice site	probably benign
R1563:Tex14	UTSW	11	87536808	missense	probably damaging	0.99
R1607:Tex14	UTSW	11	87554928	missense	probably damaging	1.00
R1696:Tex14	UTSW	11	87511545	missense	possibly damaging	0.49
R1873:Tex14	UTSW	11	87499605	missense	probably damaging	1.00
R1894:Tex14	UTSW	11	87474448	missense	probably damaging	1.00
R1911:Tex14	UTSW	11	87495035	missense	probably damaging	1.00
R1955:Tex14	UTSW	11	87509621	missense	probably damaging	1.00
R1971:Tex14	UTSW	11	87511605	missense	probably damaging	1.00
R1990:Tex14	UTSW	11	87549470	missense	probably damaging	1.00
R1991:Tex14	UTSW	11	87549470	missense	probably damaging	1.00
R1993:Tex14	UTSW	11	87536755	missense	possibly damaging	0.57
R2106:Tex14	UTSW	11	87486250	missense	possibly damaging	0.47
R2118:Tex14	UTSW	11	87519743	splice site	probably benign
R2860:Tex14	UTSW	11	87474417	missense	probably damaging	1.00
R2861:Tex14	UTSW	11	87474417	missense	probably damaging	1.00
R4016:Tex14	UTSW	11	87538623	splice site	probably null
R4089:Tex14	UTSW	11	87512203	missense	probably damaging	1.00
R4158:Tex14	UTSW	11	87516769	missense	probably benign	0.06
R4533:Tex14	UTSW	11	87536829	nonsense	probably null
R4713:Tex14	UTSW	11	87536865	missense	probably damaging	0.99
R4758:Tex14	UTSW	11	87514485	missense	probably benign	0.00
R4880:Tex14	UTSW	11	87486295	missense	possibly damaging	0.95
R4953:Tex14	UTSW	11	87536901	critical splice donor site	probably null
R5092:Tex14	UTSW	11	87514842	missense	probably benign	0.03
R5119:Tex14	UTSW	11	87433813	missense	probably damaging	1.00
R5322:Tex14	UTSW	11	87511472	missense	probably benign	0.04
R5470:Tex14	UTSW	11	87551604	missense	probably damaging	0.99
R5607:Tex14	UTSW	11	87522578	missense	probably benign	0.00
R5642:Tex14	UTSW	11	87514220	missense	probably benign
R5643:Tex14	UTSW	11	87535626	missense	probably damaging	1.00
R5786:Tex14	UTSW	11	87514295	missense	probably damaging	0.97
R6478:Tex14	UTSW	11	87514373	missense	probably benign
R6661:Tex14	UTSW	11	87495016	missense	probably damaging	1.00
R7037:Tex14	UTSW	11	87497915	missense	probably damaging	1.00
R7156:Tex14	UTSW	11	87484719	missense	probably damaging	0.99
R7465:Tex14	UTSW	11	87514430	missense	possibly damaging	0.48
R7675:Tex14	UTSW	11	87509678	missense	probably damaging	1.00
R7725:Tex14	UTSW	11	87495042	missense	probably damaging	0.99
R7911:Tex14	UTSW	11	87533602	critical splice donor site	probably null
R8015:Tex14	UTSW	11	87509600	missense	probably benign	0.13
R8226:Tex14	UTSW	11	87484759	missense	probably damaging	0.96
R8283:Tex14	UTSW	11	87474415	missense	probably damaging	1.00
R8292:Tex14	UTSW	11	87497838	missense	probably damaging	1.00
RF018:Tex14	UTSW	11	87514746	missense	probably benign	0.01
X0017:Tex14	UTSW	11	87535549	nonsense	probably null
Z1176:Tex14	UTSW	11	87484807	missense	probably benign	0.08
Z1176:Tex14	UTSW	11	87499593	missense	possibly damaging	0.95
Z1177:Tex14	UTSW	11	87514155	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AGAGCCCATCTTAAACGCTG -3'
(R):5'- GGCATGCTTATCAGCCTTATCTG -3'

Sequencing Primer
(F):5'- CAAGATCTCATGTAGTCCAGACTGG -3'
(R):5'- GGATTTACAAGTCAATCTTCCAAAGG -3'

Posted On

2018-06-06