Incidental Mutation 'R6560:Dio2'
ID522029
Institutional Source Beutler Lab
Gene Symbol Dio2
Ensembl Gene ENSMUSG00000007682
Gene Namedeiodinase, iodothyronine, type II
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R6560 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location90724552-90738438 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to C at 90729833 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 127 (S127*)
Ref Sequence ENSEMBL: ENSMUSP00000081013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082432]
Predicted Effect probably null
Transcript: ENSMUST00000082432
AA Change: S127*
SMART Domains Protein: ENSMUSP00000081013
Gene: ENSMUSG00000007682
AA Change: S127*

DomainStartEndE-ValueType
Pfam:T4_deiodinase 4 259 1.6e-119 PFAM
Pfam:AhpC-TSA 78 237 1.2e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the iodothyronine deiodinase family. It catalyzes the conversion of prohormone thyroxine (3,5,3',5'-tetraiodothyronine, T4) to the bioactive thyroid hormone (3,5,3'-triiodothyronine, T3) by outer ring 5'-deiodination. This gene is highly expressed in brain, placenta and mammary gland. It is thought to be responsible for the 'local' production of T3, and thus important in influencing thyroid hormone action in these tissues. Knockout studies in mice suggest that this gene may play an important role in brown adipose tissue lipogenesis, auditory function, and bone formation. This protein is a selenoprotein containing the rare selenocysteine (Sec) amino acid at its active site, and may contain additional Sec residues. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display elevated thyroxine (T4) and thyroid-stimulating hormone levels, changes in the metabolism and excretion of iodothyronines, and impaired adaptive thermogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 80,007,396 L1235Q probably damaging Het
Acin1 T C 14: 54,678,833 T174A probably benign Het
Adamtsl1 G A 4: 86,336,893 R733H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Arsk A T 13: 76,074,986 I164N probably benign Het
Bbs5 T A 2: 69,656,956 N194K probably damaging Het
Bicra T C 7: 15,989,194 T133A possibly damaging Het
Card6 G A 15: 5,098,885 P1010S probably damaging Het
Ccdc18 T A 5: 108,191,924 N778K probably benign Het
Cept1 T C 3: 106,505,278 I240V possibly damaging Het
Crip3 A G 17: 46,431,036 R150G probably damaging Het
Cyp2c50 A G 19: 40,096,855 T320A probably benign Het
Dscam T C 16: 96,825,735 S325G probably benign Het
Exosc4 A G 15: 76,327,613 I41V probably benign Het
Glb1l3 C T 9: 26,828,424 probably null Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm3072 T A 14: 41,623,553 D89V unknown Het
Gosr2 T C 11: 103,686,682 H79R probably damaging Het
Has2 T A 15: 56,668,264 T352S probably damaging Het
Insig1 T A 5: 28,071,533 C32* probably null Het
Klf9 A G 19: 23,141,950 S66G probably damaging Het
Mfn1 T C 3: 32,569,516 I263T probably damaging Het
Myl2 G A 5: 122,102,771 G38R probably null Het
Negr1 A G 3: 157,312,857 T332A probably benign Het
Neo1 A G 9: 58,880,601 S1417P possibly damaging Het
Olfr599 T C 7: 103,338,738 F228S probably benign Het
Olfr859 G A 9: 19,809,116 S266N probably benign Het
Pcgf3 C A 5: 108,473,902 H35Q probably damaging Het
Plppr5 A G 3: 117,671,990 I297V probably benign Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Prx A T 7: 27,515,321 Q85H probably damaging Het
Tex14 T G 11: 87,497,862 M305R possibly damaging Het
Wdr63 T C 3: 146,095,406 E99G possibly damaging Het
Ythdc1 T C 5: 86,816,608 V92A probably benign Het
Zfp619 G A 7: 39,537,530 E995K probably damaging Het
Zfp90 A G 8: 106,415,747 R4G probably damaging Het
Other mutations in Dio2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02665:Dio2 APN 12 90729653 missense possibly damaging 0.87
IGL02832:Dio2 APN 12 90729404 utr 3 prime probably benign
R0139:Dio2 UTSW 12 90729843 missense probably damaging 1.00
R0620:Dio2 UTSW 12 90738071 missense probably benign 0.24
R0908:Dio2 UTSW 12 90729648 missense probably damaging 1.00
R1106:Dio2 UTSW 12 90738211 missense probably damaging 1.00
R1799:Dio2 UTSW 12 90729906 missense probably benign 0.00
R2099:Dio2 UTSW 12 90729823 makesense probably null
R2101:Dio2 UTSW 12 90729823 makesense probably null
R4615:Dio2 UTSW 12 90729821 missense probably damaging 1.00
R6960:Dio2 UTSW 12 90729897 missense probably damaging 0.97
R7587:Dio2 UTSW 12 90729560 missense probably benign 0.00
Z1177:Dio2 UTSW 12 90729912 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCGGTGCTTCTTAACCTCAAAAG -3'
(R):5'- ACAGCAGCAGTGTGTTAGTG -3'

Sequencing Primer
(F):5'- GTGCTTCTTAACCTCAAAAGACAGAG -3'
(R):5'- CAGCAGTGTGTTAGTGTGCTAATTC -3'
Posted On2018-06-06