Mutagenetix > Incidental Mutations

Incidental Mutation 'R6560:Card6'

522037

Institutional Source

Beutler Lab

Gene Symbol

Card6

Ensembl Gene

ENSMUSG00000041849

Gene Name

caspase recruitment domain family, member 6

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6560 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

5095981-5108539 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 5098885 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 1010 (P1010S)

Ref Sequence

ENSEMBL: ENSMUSP00000112833 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000118365]

Predicted Effect

probably damaging
Transcript: ENSMUST00000118365
AA Change: P1010S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112833
Gene: ENSMUSG00000041849
AA Change: P1010S

Domain	Start	End	E-Value	Type
CARD	3	89	2.13e-5	SMART
low complexity region	237	245	N/A	INTRINSIC
low complexity region	257	273	N/A	INTRINSIC
Blast:PGAM	278	656	7e-45	BLAST
low complexity region	919	935	N/A	INTRINSIC
low complexity region	946	961	N/A	INTRINSIC
internal_repeat_1	962	1041	6.5e-13	PROSPERO
internal_repeat_1	1039	1101	6.5e-13	PROSPERO
low complexity region	1107	1132	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a caspase recruitment domain (CARD), an antiparallel six-helical bundle that mediates homotypic protein-protein interactions. The encoded protein is a microtubule-associated protein that has been shown to interact with receptor-interacting protein kinases and positively modulate signal transduction pathways converging on activation of the inducible transcription factor NF-kB. [provided by RefSeq, Jul 2008]
PHENOTYPE: Knockout mice are viable and grossly normal with no deficits in thymocytes, granulocytes, macrophages, NK cells or T- and B-cell subsets. Various signaling pathways mediating innate and adaptive immune responses appear unaltered. Mice are normally resistant to infection by a wide range of pathogens. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca7	T	A	10: 80,007,396	L1235Q	probably damaging	Het
Acin1	T	C	14: 54,678,833	T174A	probably benign	Het
Adamtsl1	G	A	4: 86,336,893	R733H	probably damaging	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Arsk	A	T	13: 76,074,986	I164N	probably benign	Het
Bbs5	T	A	2: 69,656,956	N194K	probably damaging	Het
Bicra	T	C	7: 15,989,194	T133A	possibly damaging	Het
Ccdc18	T	A	5: 108,191,924	N778K	probably benign	Het
Cept1	T	C	3: 106,505,278	I240V	possibly damaging	Het
Crip3	A	G	17: 46,431,036	R150G	probably damaging	Het
Cyp2c50	A	G	19: 40,096,855	T320A	probably benign	Het
Dio2	G	C	12: 90,729,833	S127*	probably null	Het
Dscam	T	C	16: 96,825,735	S325G	probably benign	Het
Exosc4	A	G	15: 76,327,613	I41V	probably benign	Het
Glb1l3	C	T	9: 26,828,424		probably null	Het
Gm10801	C	CGTG	2: 98,663,807		probably null	Het
Gm3072	T	A	14: 41,623,553	D89V	unknown	Het
Gosr2	T	C	11: 103,686,682	H79R	probably damaging	Het
Has2	T	A	15: 56,668,264	T352S	probably damaging	Het
Insig1	T	A	5: 28,071,533	C32*	probably null	Het
Klf9	A	G	19: 23,141,950	S66G	probably damaging	Het
Mfn1	T	C	3: 32,569,516	I263T	probably damaging	Het
Myl2	G	A	5: 122,102,771	G38R	probably null	Het
Negr1	A	G	3: 157,312,857	T332A	probably benign	Het
Neo1	A	G	9: 58,880,601	S1417P	possibly damaging	Het
Olfr599	T	C	7: 103,338,738	F228S	probably benign	Het
Olfr859	G	A	9: 19,809,116	S266N	probably benign	Het
Pcgf3	C	A	5: 108,473,902	H35Q	probably damaging	Het
Plppr5	A	G	3: 117,671,990	I297V	probably benign	Het
Plxna4	C	T	6: 32,215,678	V783M	probably damaging	Het
Prx	A	T	7: 27,515,321	Q85H	probably damaging	Het
Tex14	T	G	11: 87,497,862	M305R	possibly damaging	Het
Wdr63	T	C	3: 146,095,406	E99G	possibly damaging	Het
Ythdc1	T	C	5: 86,816,608	V92A	probably benign	Het
Zfp619	G	A	7: 39,537,530	E995K	probably damaging	Het
Zfp90	A	G	8: 106,415,747	R4G	probably damaging	Het

Other mutations in Card6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00755:Card6	APN	15	5098941	missense	possibly damaging	0.93
IGL01307:Card6	APN	15	5100002	missense	possibly damaging	0.93
IGL02016:Card6	APN	15	5108256	missense	probably damaging	1.00
IGL02976:Card6	APN	15	5099828	nonsense	probably null
IGL03328:Card6	APN	15	5105445	splice site	probably benign
IGL03356:Card6	APN	15	5100241	missense	probably benign	0.00
Mark	UTSW	15	5098691	small deletion	probably benign
sharps	UTSW	15	5099896	nonsense	probably null
PIT4131001:Card6	UTSW	15	5108306	missense	probably damaging	1.00
PIT4142001:Card6	UTSW	15	5098631	missense	unknown
PIT4458001:Card6	UTSW	15	5098691	small deletion	probably benign
R0562:Card6	UTSW	15	5105166	missense	probably damaging	1.00
R0943:Card6	UTSW	15	5100286	missense	probably damaging	1.00
R1654:Card6	UTSW	15	5098732	missense	probably benign	0.00
R3892:Card6	UTSW	15	5099296	missense	probably benign	0.01
R4408:Card6	UTSW	15	5101054	missense	probably damaging	0.97
R4856:Card6	UTSW	15	5105141	splice site	probably null
R4886:Card6	UTSW	15	5105141	splice site	probably null
R4998:Card6	UTSW	15	5100082	missense	probably benign	0.00
R5050:Card6	UTSW	15	5100376	missense	probably benign	0.00
R5365:Card6	UTSW	15	5105406	missense	possibly damaging	0.53
R5518:Card6	UTSW	15	5105214	missense	probably damaging	0.99
R5686:Card6	UTSW	15	5100953	missense	probably damaging	0.99
R6088:Card6	UTSW	15	5105019	missense	possibly damaging	0.56
R6194:Card6	UTSW	15	5098444	missense	unknown
R6336:Card6	UTSW	15	5099164	nonsense	probably null
R6539:Card6	UTSW	15	5105391	missense	probably damaging	0.99
R7132:Card6	UTSW	15	5098691	small deletion	probably benign
R7157:Card6	UTSW	15	5100109	missense	probably benign	0.07
R7174:Card6	UTSW	15	5098691	small deletion	probably benign
R7186:Card6	UTSW	15	5098691	small deletion	probably benign
R7338:Card6	UTSW	15	5099872	missense	probably benign	0.09
R7430:Card6	UTSW	15	5099200	missense	probably benign	0.00
R7579:Card6	UTSW	15	5098691	small deletion	probably benign
R7677:Card6	UTSW	15	5098444	missense	unknown
R7718:Card6	UTSW	15	5099787	missense	possibly damaging	0.54
R7720:Card6	UTSW	15	5098423	missense	unknown
R7756:Card6	UTSW	15	5099896	nonsense	probably null
R7758:Card6	UTSW	15	5099896	nonsense	probably null
R7762:Card6	UTSW	15	5105338	missense	probably benign
R7786:Card6	UTSW	15	5098691	small deletion	probably benign
R7808:Card6	UTSW	15	5099472	missense	probably benign	0.00
R7817:Card6	UTSW	15	5098691	small deletion	probably benign
R7822:Card6	UTSW	15	5098865	missense	possibly damaging	0.82
R7902:Card6	UTSW	15	5098691	small deletion	probably benign
R7977:Card6	UTSW	15	5100525	missense	probably damaging	1.00
R7987:Card6	UTSW	15	5100525	missense	probably damaging	1.00
R8295:Card6	UTSW	15	5098691	small deletion	probably benign
R8303:Card6	UTSW	15	5105365	missense	probably benign	0.13
R8431:Card6	UTSW	15	5100276	missense	probably damaging	0.98
RF013:Card6	UTSW	15	5100142	missense	probably benign	0.19

Predicted Primers

PCR Primer
(F):5'- CTTAGCATGGGAGGACTGTG -3'
(R):5'- TGCTTTCAAACCAGGGTCTC -3'

Sequencing Primer
(F):5'- ACTGTGGATGAGAGGGCTTAGC -3'
(R):5'- CAGGGTCTCAATCTACATCTGGGAG -3'

Posted On

2018-06-06