Incidental Mutation 'R6560:Has2'
ID522038
Institutional Source Beutler Lab
Gene Symbol Has2
Ensembl Gene ENSMUSG00000022367
Gene Namehyaluronan synthase 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6560 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location56665627-56694539 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56668264 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 352 (T352S)
Ref Sequence ENSEMBL: ENSMUSP00000062212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050544]
Predicted Effect probably damaging
Transcript: ENSMUST00000050544
AA Change: T352S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062212
Gene: ENSMUSG00000022367
AA Change: T352S

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
Pfam:Glycos_transf_2 86 156 1.7e-7 PFAM
Pfam:Glyco_tranf_2_3 159 357 1.2e-17 PFAM
Pfam:Chitin_synth_2 193 464 1.9e-17 PFAM
Pfam:Glyco_trans_2_3 207 534 1.3e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hyaluronan or hyaluronic acid (HA) is a high molecular weight unbranched polysaccharide synthesized by a wide variety of organisms from bacteria to mammals, and is a constituent of the extracellular matrix. It consists of alternating glucuronic acid and N-acetylglucosamine residues that are linked by beta-1-3 and beta-1-4 glycosidic bonds. HA is synthesized by membrane-bound synthase at the inner surface of the plasma membrane, and the chains are extruded through pore-like structures into the extracellular space. It serves a variety of functions, including space filling, lubrication of joints, and provision of a matrix through which cells can migrate. HA is actively produced during wound healing and tissue repair to provide a framework for ingrowth of blood vessels and fibroblasts. Changes in the serum concentration of HA are associated with inflammatory and degenerative arthropathies such as rheumatoid arthritis. In addition, the interaction of HA with the leukocyte receptor CD44 is important in tissue-specific homing by leukocytes, and overexpression of HA receptors has been correlated with tumor metastasis. HAS2 is a member of the newly identified vertebrate gene family encoding putative hyaluronan synthases, and its amino acid sequence shows significant homology to glycosaminoglycan synthetase (DG42) from Xenopus laevis, and human and murine hyaluronan synthase 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation die during midgestation with severe defects in yolk sac and systemic vasculature, including pericardial edema, compaction of the extracellular space, and absence of endocardial cushions and trabeculae. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 80,007,396 L1235Q probably damaging Het
Acin1 T C 14: 54,678,833 T174A probably benign Het
Adamtsl1 G A 4: 86,336,893 R733H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Arsk A T 13: 76,074,986 I164N probably benign Het
Bbs5 T A 2: 69,656,956 N194K probably damaging Het
Bicra T C 7: 15,989,194 T133A possibly damaging Het
Card6 G A 15: 5,098,885 P1010S probably damaging Het
Ccdc18 T A 5: 108,191,924 N778K probably benign Het
Cept1 T C 3: 106,505,278 I240V possibly damaging Het
Crip3 A G 17: 46,431,036 R150G probably damaging Het
Cyp2c50 A G 19: 40,096,855 T320A probably benign Het
Dio2 G C 12: 90,729,833 S127* probably null Het
Dscam T C 16: 96,825,735 S325G probably benign Het
Exosc4 A G 15: 76,327,613 I41V probably benign Het
Glb1l3 C T 9: 26,828,424 probably null Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm3072 T A 14: 41,623,553 D89V unknown Het
Gosr2 T C 11: 103,686,682 H79R probably damaging Het
Insig1 T A 5: 28,071,533 C32* probably null Het
Klf9 A G 19: 23,141,950 S66G probably damaging Het
Mfn1 T C 3: 32,569,516 I263T probably damaging Het
Myl2 G A 5: 122,102,771 G38R probably null Het
Negr1 A G 3: 157,312,857 T332A probably benign Het
Neo1 A G 9: 58,880,601 S1417P possibly damaging Het
Olfr599 T C 7: 103,338,738 F228S probably benign Het
Olfr859 G A 9: 19,809,116 S266N probably benign Het
Pcgf3 C A 5: 108,473,902 H35Q probably damaging Het
Plppr5 A G 3: 117,671,990 I297V probably benign Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Prx A T 7: 27,515,321 Q85H probably damaging Het
Tex14 T G 11: 87,497,862 M305R possibly damaging Het
Wdr63 T C 3: 146,095,406 E99G possibly damaging Het
Ythdc1 T C 5: 86,816,608 V92A probably benign Het
Zfp619 G A 7: 39,537,530 E995K probably damaging Het
Zfp90 A G 8: 106,415,747 R4G probably damaging Het
Other mutations in Has2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Has2 APN 15 56681676 missense possibly damaging 0.51
IGL02027:Has2 APN 15 56668171 missense probably damaging 1.00
IGL02178:Has2 APN 15 56682060 missense probably damaging 1.00
IGL02493:Has2 APN 15 56667924 missense probably damaging 1.00
IGL02533:Has2 APN 15 56681695 missense probably benign 0.00
IGL03142:Has2 APN 15 56682095 missense possibly damaging 0.92
IGL03240:Has2 APN 15 56668260 missense probably damaging 1.00
R0189:Has2 UTSW 15 56668435 missense probably damaging 1.00
R0362:Has2 UTSW 15 56681661 missense probably damaging 1.00
R1377:Has2 UTSW 15 56681806 missense probably damaging 1.00
R1762:Has2 UTSW 15 56681610 missense probably benign 0.13
R1845:Has2 UTSW 15 56668578 missense probably damaging 1.00
R2012:Has2 UTSW 15 56667868 missense probably damaging 1.00
R2190:Has2 UTSW 15 56667787 missense probably benign 0.00
R2656:Has2 UTSW 15 56681828 missense possibly damaging 0.90
R2966:Has2 UTSW 15 56682137 missense probably damaging 1.00
R4361:Has2 UTSW 15 56681948 missense probably damaging 1.00
R5698:Has2 UTSW 15 56667916 missense probably damaging 1.00
R5826:Has2 UTSW 15 56668102 missense probably damaging 1.00
R5883:Has2 UTSW 15 56668063 missense possibly damaging 0.49
R5942:Has2 UTSW 15 56667796 nonsense probably null
R6433:Has2 UTSW 15 56667798 missense possibly damaging 0.79
R6603:Has2 UTSW 15 56668572 missense probably damaging 1.00
R7094:Has2 UTSW 15 56681621 missense probably damaging 1.00
R7597:Has2 UTSW 15 56668421 missense probably damaging 1.00
R7738:Has2 UTSW 15 56667712 missense possibly damaging 0.89
R8060:Has2 UTSW 15 56669945 missense probably benign 0.00
Z1177:Has2 UTSW 15 56681583 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGAGACCCACTAGCTGGACAG -3'
(R):5'- TGTACAGAAACTCCTTGCTGC -3'

Sequencing Primer
(F):5'- CCACTAGCTGGACAGTTAACAGG -3'
(R):5'- CAGAAACTCCTTGCTGCATGAATTTG -3'
Posted On2018-06-06