Incidental Mutation 'R6560:Exosc4'
ID522040
Institutional Source Beutler Lab
Gene Symbol Exosc4
Ensembl Gene ENSMUSG00000034259
Gene Nameexosome component 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R6560 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location76327397-76330677 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76327613 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 41 (I41V)
Ref Sequence ENSEMBL: ENSMUSP00000155254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023221] [ENSMUST00000059045] [ENSMUST00000164972] [ENSMUST00000165279] [ENSMUST00000169378] [ENSMUST00000170121] [ENSMUST00000172281] [ENSMUST00000230512]
Predicted Effect probably benign
Transcript: ENSMUST00000023221
SMART Domains Protein: ENSMUSP00000023221
Gene: ENSMUSG00000022561

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 68 81 N/A INTRINSIC
Pfam:Gaa1 125 615 3.8e-155 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059045
AA Change: I41V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000050940
Gene: ENSMUSG00000034259
AA Change: I41V

DomainStartEndE-ValueType
Pfam:RNase_PH 21 152 5.1e-37 PFAM
Pfam:RNase_PH_C 155 220 1.9e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164680
Predicted Effect probably benign
Transcript: ENSMUST00000164972
SMART Domains Protein: ENSMUSP00000127108
Gene: ENSMUSG00000022561

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165279
SMART Domains Protein: ENSMUSP00000127955
Gene: ENSMUSG00000022562

DomainStartEndE-ValueType
Pfam:Hydant_A_N 9 53 8.2e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168948
SMART Domains Protein: ENSMUSP00000126326
Gene: ENSMUSG00000022561

DomainStartEndE-ValueType
Pfam:Gaa1 1 129 1.9e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169378
SMART Domains Protein: ENSMUSP00000128507
Gene: ENSMUSG00000022561

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170121
SMART Domains Protein: ENSMUSP00000133173
Gene: ENSMUSG00000022561

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172281
SMART Domains Protein: ENSMUSP00000132986
Gene: ENSMUSG00000022561

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Gaa1 64 560 3e-205 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000230512
AA Change: I41V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230818
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 80,007,396 L1235Q probably damaging Het
Acin1 T C 14: 54,678,833 T174A probably benign Het
Adamtsl1 G A 4: 86,336,893 R733H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Arsk A T 13: 76,074,986 I164N probably benign Het
Bbs5 T A 2: 69,656,956 N194K probably damaging Het
Bicra T C 7: 15,989,194 T133A possibly damaging Het
Card6 G A 15: 5,098,885 P1010S probably damaging Het
Ccdc18 T A 5: 108,191,924 N778K probably benign Het
Cept1 T C 3: 106,505,278 I240V possibly damaging Het
Crip3 A G 17: 46,431,036 R150G probably damaging Het
Cyp2c50 A G 19: 40,096,855 T320A probably benign Het
Dio2 G C 12: 90,729,833 S127* probably null Het
Dscam T C 16: 96,825,735 S325G probably benign Het
Glb1l3 C T 9: 26,828,424 probably null Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm3072 T A 14: 41,623,553 D89V unknown Het
Gosr2 T C 11: 103,686,682 H79R probably damaging Het
Has2 T A 15: 56,668,264 T352S probably damaging Het
Insig1 T A 5: 28,071,533 C32* probably null Het
Klf9 A G 19: 23,141,950 S66G probably damaging Het
Mfn1 T C 3: 32,569,516 I263T probably damaging Het
Myl2 G A 5: 122,102,771 G38R probably null Het
Negr1 A G 3: 157,312,857 T332A probably benign Het
Neo1 A G 9: 58,880,601 S1417P possibly damaging Het
Olfr599 T C 7: 103,338,738 F228S probably benign Het
Olfr859 G A 9: 19,809,116 S266N probably benign Het
Pcgf3 C A 5: 108,473,902 H35Q probably damaging Het
Plppr5 A G 3: 117,671,990 I297V probably benign Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Prx A T 7: 27,515,321 Q85H probably damaging Het
Tex14 T G 11: 87,497,862 M305R possibly damaging Het
Wdr63 T C 3: 146,095,406 E99G possibly damaging Het
Ythdc1 T C 5: 86,816,608 V92A probably benign Het
Zfp619 G A 7: 39,537,530 E995K probably damaging Het
Zfp90 A G 8: 106,415,747 R4G probably damaging Het
Other mutations in Exosc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02064:Exosc4 APN 15 76329636 missense probably damaging 1.00
R0499:Exosc4 UTSW 15 76329566 missense probably benign 0.01
R0622:Exosc4 UTSW 15 76327536 missense probably damaging 1.00
R0718:Exosc4 UTSW 15 76329489 missense probably benign 0.01
R0733:Exosc4 UTSW 15 76329416 missense probably benign
R0930:Exosc4 UTSW 15 76327534 missense probably benign 0.13
R4881:Exosc4 UTSW 15 76329570 missense probably damaging 1.00
R8247:Exosc4 UTSW 15 76329079 missense probably damaging 0.99
R8269:Exosc4 UTSW 15 76327532 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGTCGTAGTCCTGAAGGTCCAG -3'
(R):5'- ATCCCCGCTACAACACGTTG -3'

Sequencing Primer
(F):5'- AAGGTCCAGGTCGAGCTGTC -3'
(R):5'- ACAACCTGTGTGAGATGCTTTC -3'
Posted On2018-06-06